Entry information : SmPrx18-1_79 (SmPrx18a_79)
Entry ID 6989
Creation 2009-09-30 (Paula Nunes)
Last sequence changes 2009-09-30 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx18-1_79 (SmPrx18a_79)
Name (synonym) SmPrx18-1_79 (SmPrx18a_79)
Class Class III peroxidase    [Orthogroup: Prx047]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx18-1_79
start..stop
S start..stop
SmPrx18-2_30 682 0 1..334 1..334
SmPrx01-1_122 327 6e-112 28..324 25..321
SmPrx01-2_114 325 3e-111 28..324 25..321
SmPrx09-2_89 325 9e-111 4..333 9..338
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 574054..574260 207 N° 2 573738..573932 195 N° 3 573519..573684 166 N° 4 573026..573462 437
complement(join(573026..573462,573519..573684,573738..573932,574054..574260))


exon

Literature and cross-references SmPrx18-1_79 (SmPrx18a_79)
DNA ref. Phytozome 12:   scaffold_79 (574260..573026)
mRNA ref. JGI transcript:   182951
EST ref. GenBank:   FE475721.1 [5' end]   FE475720.1 [3' end]
Protein sequence: SmPrx18-1_79 (SmPrx18a_79)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334 (311)
PWM (Da):   %s   36399.66 (33970.4)  
PI (pH):   %s   7.94 (7.99) Peptide Signal:   %s   cut: 24 range:24-334
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKFLVLIFAVFACSSVLLSSSDALEIGYYNKVCPLAEAIVSATVFKHFLQNRTVPAALIRLHFHDCFVRGCDGSLLLDVTPGGQVVEKEALPNKGSVRGFEIIDEAKDAITAVCGNVVSCADVLALSARDSFFLTSGLYYQLPTGRFDGRTSLASEAIPNLPAFTLTAAELKANFARKKLNTNDLIVLSGGHTLGRATCAAFTHRLYNFQNTSRPDPTLSQDYLRILRGICPQSGNPSPRVQLDKGTEFIFDNSYYAEIVKNNGLLQTDQELLFDQETSATIRSFAKDNLSFLKQFSQSMINMGAIEVKTAKDGEIRRKCNVPNSGRISSHATE

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). 2 ESTs
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTTCCTAGTGCTAATCTTTGCCGTGTTCGCGTGTTCTTCGGTGTTGTTGAGCTCCTCCGACGCTCTGGAGATCGGCTACTACAACAAGGTCTGCCCGCTCGCGGAAGCGATCGTC
TCGGCCACCGTCTTTAAGCACTTCTTGCAAAACCGGACCGTCCCAGCGGCGCTCATCCGGCTGCATTTCCACGATTGTTTTGTGAGG
GTAAAGTTCTTCTTGGCTCGGATCTTTGGATCA
TCAATGTTTATTTCTTTGGATCGTCACTCAATTGTTTGGCACCGACAACGTTCTAGCTAAATGACGTTATATGACTGTTCTTTGACAGGGGTGTGATGGATCGTTGTTGCTGGACGTTAC
ACCCGGTGGCCAAGTTGTGGAGAAGGAAGCCCTCCCCAACAAAGGCTCCGTCCGAGGATTCGAGATCATCGACGAAGCCAAGGACGCCATCACCGCCGTGTGTGGAAACGTTGTGTCGTG
CGCAGATGTCCTCGCCCTCTCGGCTCGGGACTCTTTCTTCCTG
GTAAGTTTTGCAAGAACTCCTCGGTTAAAACTTTAAATTCTACTGTGGAGCAGACTAGTGGGCTCTATTATCAATTA
CCCACGGGGAGATTCGATGGAAGAACGTCGCTGGCGTCGGAGGCTATCCCAAACCTCCCGGCATTTACCCTCACTGCGGCGGAGCTCAAGGCTAACTTTGCTAGAAAGAAACTCAACACA
AACGATCTCATCGTCCTCTCAG
GTGAACTTAGTATGATCCGGGAGCCTTTCACTGAAAGATGTGGGCAATCTTCGCAGGAGGACACACTCTCGGACGAGCAACCTGTGCGGCATTCACCC
ACAGGCTCTACAATTTCCAGAACACGAGCCGCCCGGATCCAACTCTCAGCCAGGACTACTTGAGGATCTTGCGTGGGATTTGTCCCCAGTCCGGGAATCCCAGCCCGCGGGTCCAGCTCG
ACAAAGGCACCGAGTTTATCTTTGACAATAGCTACTACGCGGAAATTGTCAAAAACAATGGGCTGCTCCAGACGGATCAAGAGCTCCTGTTTGATCAGGAGACCAGCGCGACTATCCGTA
GCTTTGCCAAGGATAATCTCAGCTTCTTGAAGCAATTCTCTCAGTCCATGATCAACATGGGGGCGATCGAGGTTAAAACTGCAAAGGATGGAGAGATCCGGAGGAAGTGTAATGTTCCAA
ACAGTGGGCGCATATCGAGCCATGCAACTGAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTTCCTAGTGCTAATCTTTGCCGTGTTCGCGTGTTCTTCGGTGTTGTTGAGCTCCTCCGACGCTCTGGAGATCGGCTACTACAACAAGGTCTGCCCGCTCGCGGAAGCGATCGTC
TCGGCCACCGTCTTTAAGCACTTCTTGCAAAACCGGACCGTCCCAGCGGCGCTCATCCGGCTGCATTTCCACGATTGTTTTGTGAGG
GGGTGTGATGGATCGTTGTTGCTGGACGTTACA
CCCGGTGGCCAAGTTGTGGAGAAGGAAGCCCTCCCCAACAAAGGCTCCGTCCGAGGATTCGAGATCATCGACGAAGCCAAGGACGCCATCACCGCCGTGTGTGGAAACGTTGTGTCGTGC
GCAGATGTCCTCGCCCTCTCGGCTCGGGACTCTTTCTTCCTG
ACTAGTGGGCTCTATTATCAATTACCCACGGGGAGATTCGATGGAAGAACGTCGCTGGCGTCGGAGGCTATCCCAAAC
CTCCCGGCATTTACCCTCACTGCGGCGGAGCTCAAGGCTAACTTTGCTAGAAAGAAACTCAACACAAACGATCTCATCGTCCTCTCAG
GAGGACACACTCTCGGACGAGCAACCTGTGCG
GCATTCACCCACAGGCTCTACAATTTCCAGAACACGAGCCGCCCGGATCCAACTCTCAGCCAGGACTACTTGAGGATCTTGCGTGGGATTTGTCCCCAGTCCGGGAATCCCAGCCCGCGG
GTCCAGCTCGACAAAGGCACCGAGTTTATCTTTGACAATAGCTACTACGCGGAAATTGTCAAAAACAATGGGCTGCTCCAGACGGATCAAGAGCTCCTGTTTGATCAGGAGACCAGCGCG
ACTATCCGTAGCTTTGCCAAGGATAATCTCAGCTTCTTGAAGCAATTCTCTCAGTCCATGATCAACATGGGGGCGATCGAGGTTAAAACTGCAAAGGATGGAGAGATCCGGAGGAAGTGT
AATGTTCCAAACAGTGGGCGCATATCGAGCCATGCAACTGAGTAA

Retrieve as FASTA