Entry information : SmPrx18-2_30 (SmPrx18b_30)
Entry ID 6990
Creation 2009-10-06 (Christophe Dunand)
Last sequence changes 2009-10-06 (Christophe Dunand)
Sequence status complete
Reviewer Paula Nunes
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx18-2_30 (SmPrx18b_30)
Name (synonym) SmPrx18-2_30 (SmPrx18b_30)
Class Class III peroxidase    [Orthogroup: Prx047]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx18-2_30
start..stop
S start..stop
SmPrx18-1_79 682 0 1..334 1..334
SmPrx01-1_122 327 1e-111 28..324 25..321
SmPrx01-2_114 325 5e-111 28..324 25..321
SmPrx09-2_89 323 3e-110 4..333 9..338
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 557857..558063 207 N° 2 557541..557735 195 N° 3 557322..557487 166 N° 4 556829..557265 437
complement(join(556829..557265,557322..557487,557541..557735,557857..558063))


exon

Literature and cross-references SmPrx18-2_30 (SmPrx18b_30)
DNA ref. Phytozome 12:   scaffold_30 (558063..556829)
mRNA ref. JGI transcript:   104946
Protein sequence: SmPrx18-2_30 (SmPrx18b_30)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334 (311)
PWM (Da):   %s   36404.58 (33957.4)  
PI (pH):   %s   7.69 (7.73) Peptide Signal:   %s   cut: 24 range:24-334
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKFLVLMFAVFACSSVLLSSSDALEIGYYNKVCPLAEAIVSATVFKHFLQNRTVPAALIRLHFHDCFVRGCDGSLLLDVTPGGEVVEKEALPNKGSVRGFEIIDEAKDAITAVCGNVVSCADVLALSARDSFFLTSGLYYNLPTGRFDGRTSLASEAIPNLPAFTLTAAELKANFARKKLNTNDLIVLSGGHTLGRATCAAFTHRLYNFQNTSRPDPTLSQDYLRILRGICPQSGNPSPRVQLDKGTEFIFDNSYYAEIVKNNGLLQTDQELLFDQETSATIRSFAKDNLSFLKQFSQSMINMGAIEVKTAKDGEIRRKCNVPNSGRISSHATE

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTTCCTAGTGCTGATGTTTGCCGTGTTCGCGTGTTCTTCGGTGTTGTTGAGCTCCTCCGACGCTCTGGAGATCGGCTACTACAACAAGGTCTGCCCGCTCGCGGAAGCGATCGTC
TCGGCCACCGTCTTTAAGCACTTCTTGCAAAACCGGACCGTCCCAGCGGCGCTCATCCGGCTGCATTTCCACGATTGTTTTGTGAGG
GTAAAGTTCTTCTTGGCTTGGATCTTTGGATCA
TCAATGTTTATTTCTTTGGATCGTCACTCAATTGTTTGGCACCGACAACGTTCTAGCTAAATGACGTTATATGACTGTTCTTTGACAGGGGTGTGATGGATCGTTGTTGCTGGACGTTAC
ACCCGGTGGCGAAGTCGTGGAGAAGGAAGCCCTTCCCAACAAAGGCTCCGTGCGAGGATTCGAGATCATCGACGAAGCCAAAGACGCCATCACCGCCGTGTGTGGAAACGTTGTGTCGTG
CGCAGATGTCCTCGCCCTCTCGGCCCGGGACTCTTTCTTCCTG
GTAAGTTTTGCAAGAACTCCTCGGTTAAAACTTTAAATTCTAATGTGGAGCAGACTAGTGGACTCTATTATAATTTA
CCCACGGGGAGATTCGATGGAAGAACGTCGCTGGCGTCGGAGGCTATCCCAAACCTCCCGGCATTTACCCTCACTGCGGCGGAGCTCAAGGCTAACTTTGCTAGAAAGAAACTCAACACA
AACGATCTCATCGTCCTCTCAG
GTGAACTTAGTATGATCCGGGAGCCTTTCACTGAAAGATGTGGGCAATCTTCGCAGGAGGACACACTCTCGGACGAGCAACCTGTGCGGCATTCACCC
ACAGGCTCTACAATTTCCAGAACACGAGCCGCCCGGATCCAACTCTCAGCCAGGACTACTTGAGGATCTTGCGTGGGATTTGTCCCCAGTCCGGGAATCCCAGCCCGCGGGTCCAGCTCG
ACAAAGGCACCGAGTTTATCTTTGACAACAGCTACTACGCGGAAATTGTCAAAAACAATGGGCTGCTCCAGACGGATCAAGAGCTCCTGTTTGATCAGGAGACCAGCGCGACTATCCGTA
GCTTTGCCAAGGATAATCTCAGCTTCTTGAAGCAATTCTCTCAGTCCATGATCAACATGGGGGCGATCGAGGTTAAAACTGCAAAGGATGGAGAGATCCGGAGGAAGTGTAATGTTCCAA
ACAGTGGGCGCATATCCAGCCATGCAACTGAGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGTTCCTAGTGCTGATGTTTGCCGTGTTCGCGTGTTCTTCGGTGTTGTTGAGCTCCTCCGACGCTCTGGAGATCGGCTACTACAACAAGGTCTGCCCGCTCGCGGAAGCGATCGTC
TCGGCCACCGTCTTTAAGCACTTCTTGCAAAACCGGACCGTCCCAGCGGCGCTCATCCGGCTGCATTTCCACGATTGTTTTGTGAGG
GGGTGTGATGGATCGTTGTTGCTGGACGTTACA
CCCGGTGGCGAAGTCGTGGAGAAGGAAGCCCTTCCCAACAAAGGCTCCGTGCGAGGATTCGAGATCATCGACGAAGCCAAAGACGCCATCACCGCCGTGTGTGGAAACGTTGTGTCGTGC
GCAGATGTCCTCGCCCTCTCGGCCCGGGACTCTTTCTTCCTG
ACTAGTGGACTCTATTATAATTTACCCACGGGGAGATTCGATGGAAGAACGTCGCTGGCGTCGGAGGCTATCCCAAAC
CTCCCGGCATTTACCCTCACTGCGGCGGAGCTCAAGGCTAACTTTGCTAGAAAGAAACTCAACACAAACGATCTCATCGTCCTCTCAG
GAGGACACACTCTCGGACGAGCAACCTGTGCG
GCATTCACCCACAGGCTCTACAATTTCCAGAACACGAGCCGCCCGGATCCAACTCTCAGCCAGGACTACTTGAGGATCTTGCGTGGGATTTGTCCCCAGTCCGGGAATCCCAGCCCGCGG
GTCCAGCTCGACAAAGGCACCGAGTTTATCTTTGACAACAGCTACTACGCGGAAATTGTCAAAAACAATGGGCTGCTCCAGACGGATCAAGAGCTCCTGTTTGATCAGGAGACCAGCGCG
ACTATCCGTAGCTTTGCCAAGGATAATCTCAGCTTCTTGAAGCAATTCTCTCAGTCCATGATCAACATGGGGGCGATCGAGGTTAAAACTGCAAAGGATGGAGAGATCCGGAGGAAGTGT
AATGTTCCAAACAGTGGGCGCATATCCAGCCATGCAACTGAGTAA

Retrieve as FASTA