Entry information : SmPrx06-2_11 (SmPrx06b_11)
Entry ID 6991
Creation 2009-10-06 (Christophe Dunand)
Last sequence changes 2011-01-25 (Toky Ramarohetra (Scipio))
Sequence status complete
Reviewer Paula Nunes
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx06-2_11 (SmPrx06b_11)
Name (synonym) SmPrx06-2_11 (SmPrx06b_11)
Class Class III peroxidase    [Orthogroup: Prx047]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx06-2_11
start..stop
S start..stop
SmPrx06-1_110 642 0 1..339 1..339
SmPrx05-1_110 620 0 4..339 1..336
SmPrx05-2_11 600 0 25..339 22..336
SmPrx27-1_10 407 2e-143 13..338 5..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1230647..1230859 213 N° 2 1230387..1230584 198 N° 3 1230166..1230328 163 N° 4 1229665..1230110 446
complement(join(1229665..1230110,1230166..1230328,1230387..1230584,1230647..1230 859))


exon

Literature and cross-references SmPrx06-2_11 (SmPrx06b_11)
DNA ref. Phytozome 12:   scaffold_11 (1230859..1229665)
mRNA ref. JGI transcript:   145932 [Incorrect prediction]
Protein sequence: SmPrx06-2_11 (SmPrx06b_11)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   339 (316)
PWM (Da):   %s   36373.06 (34098.9)  
PI (pH):   %s   5.82 (5.82) Peptide Signal:   %s   cut: 24 range:24-339
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASMSPQQLLCLLLIAAACSASARPDSLHSYAQSCPRAEQIVAATVKSAADRDPTTPAGIIRLFFHDCFVQGCDASILLESTPTDGREVEMFAGPNINSARGFEIIEAAKTQLEAVCPGVVSCADVLAFAARDATTYFGGMFYTVPTGRLDGRISSRTEANSLPGPASSFSQLRDIFDGKKLSVQDLVLLSGGHTIGRAKCRFVEARIYNFSGTGSPDPRLDATYREELRRICPQGANPSPTVALDRNSEFSFDNAYYRNLEANRGLLSSDAVLRTDPDAANLINSLAQNPPTFLSMFAQSMINMGNIEWKTRANGEIRKKCSAVNSRITTEVGDVASF

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No ESTs. Incorrect transcript prediction from JGI(mixed between the SmPrx05b and 06b).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCAATGTCCCCGCAGCAGCTTCTCTGCCTACTCCTCATAGCAGCAGCTTGTTCTGCGTCTGCTCGTCCCGATTCTCTTCACAGCTATGCTCAATCTTGTCCGAGAGCTGAACAG
ATAGTCGCGGCCACTGTCAAGAGTGCGGCGGACCGGGATCCAACAACACCAGCCGGCATTATCCGCTTGTTCTTCCACGACTGCTTTGTCCAA
GTAAGCTCGTCGTCCTTAGCAACTTTG
TATGTGAGTTGTGACGAATGTGTTTATTTGTCCAGGGGTGCGATGCTTCAATACTTTTGGAATCGACTCCTACTGATGGGAGAGAGGTGGAGATGTTCGCGGGCCCGAACATCAACTCTG
CTCGTGGTTTCGAGATTATCGAGGCGGCAAAGACCCAGCTGGAGGCTGTGTGCCCGGGAGTTGTGAGCTGTGCGGATGTTCTCGCGTTTGCTGCCAGGGACGCGACAACTTAC
GTAAGCA
CAAGTCGGCTATTGTTGATTTCTCTTTGACTTTGCCCGCAAATTTATGTAGTTTGGAGGGATGTTCTACACGGTGCCTACGGGTCGCCTTGACGGACGAATCTCTAGCAGAACAGAAGCC
AACAGCTTACCGGGTCCCGCTTCCTCGTTCAGTCAGCTGAGAGACATCTTCGACGGCAAAAAATTGTCAGTTCAGGACCTCGTGCTGCTCTCCG
GTAAGAAGTTTCTGTTCAAGCTAGAA
ATCTCCACCAACATTGCCGTAACTTACAGGCGGACACACCATTGGTCGCGCAAAGTGTCGATTCGTCGAGGCTCGTATCTACAACTTTAGCGGCACCGGAAGTCCCGATCCACGCCTGGA
CGCTACGTACCGTGAGGAGCTCCGGCGGATTTGCCCGCAGGGAGCAAACCCGAGCCCGACGGTGGCGCTGGACAGGAACTCGGAGTTTAGCTTCGACAACGCTTACTACAGGAACCTCGA
GGCCAACAGGGGGCTGCTTTCGTCGGACGCGGTGCTCCGGACCGACCCGGACGCTGCCAATCTCATCAACTCGCTCGCTCAGAACCCGCCAACGTTCCTCTCCATGTTCGCGCAGTCGAT
GATCAACATGGGAAACATCGAGTGGAAGACGAGAGCCAACGGGGAGATAAGGAAGAAGTGCTCGGCCGTGAACTCCAGGATCACCACCGAAGTGGGCGACGTTGCGTCCTTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCAATGTCCCCGCAGCAGCTTCTCTGCCTACTCCTCATAGCAGCAGCTTGTTCTGCGTCTGCTCGTCCCGATTCTCTTCACAGCTATGCTCAATCTTGTCCGAGAGCTGAACAG
ATAGTCGCGGCCACTGTCAAGAGTGCGGCGGACCGGGATCCAACAACACCAGCCGGCATTATCCGCTTGTTCTTCCACGACTGCTTTGTCCAA
GGGTGCGATGCTTCAATACTTTTGGAA
TCGACTCCTACTGATGGGAGAGAGGTGGAGATGTTCGCGGGCCCGAACATCAACTCTGCTCGTGGTTTCGAGATTATCGAGGCGGCAAAGACCCAGCTGGAGGCTGTGTGCCCGGGAGTT
GTGAGCTGTGCGGATGTTCTCGCGTTTGCTGCCAGGGACGCGACAACTTAC
TTTGGAGGGATGTTCTACACGGTGCCTACGGGTCGCCTTGACGGACGAATCTCTAGCAGAACAGAAGCC
AACAGCTTACCGGGTCCCGCTTCCTCGTTCAGTCAGCTGAGAGACATCTTCGACGGCAAAAAATTGTCAGTTCAGGACCTCGTGCTGCTCTCCG
GCGGACACACCATTGGTCGCGCAAAG
TGTCGATTCGTCGAGGCTCGTATCTACAACTTTAGCGGCACCGGAAGTCCCGATCCACGCCTGGACGCTACGTACCGTGAGGAGCTCCGGCGGATTTGCCCGCAGGGAGCAAACCCGAGC
CCGACGGTGGCGCTGGACAGGAACTCGGAGTTTAGCTTCGACAACGCTTACTACAGGAACCTCGAGGCCAACAGGGGGCTGCTTTCGTCGGACGCGGTGCTCCGGACCGACCCGGACGCT
GCCAATCTCATCAACTCGCTCGCTCAGAACCCGCCAACGTTCCTCTCCATGTTCGCGCAGTCGATGATCAACATGGGAAACATCGAGTGGAAGACGAGAGCCAACGGGGAGATAAGGAAG
AAGTGCTCGGCCGTGAACTCCAGGATCACCACCGAAGTGGGCGACGTTGCGTCCTTCTAG

Retrieve as FASTA