Entry information : SmPrx27-1_10 (SmPrx27a_10)
Entry ID 6992
Creation 2009-10-01 (Paula Nunes)
Last sequence changes 2009-10-01 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx27-1_10 (SmPrx27a_10)
Name (synonym) SmPrx27-1_10 (SmPrx27a_10)
Class Class III peroxidase    [Orthogroup: Prx047]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx27-1_10
start..stop
S start..stop
SmPrx27-2_14 662 0 1..332 1..332
SmPrx06-2_11 407 2e-143 27..331 35..338
SmPrx05-1_110 407 3e-143 13..331 9..335
SmPrx05-2_11 404 4e-142 26..331 31..335
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 449656..449844 189 N° 2 449919..450116 198 N° 3 450187..450352 166 N° 4 450412..450857 446
join(449656..449844,449919..450116,450187..450352,450412..450857)


exon

Literature and cross-references SmPrx27-1_10 (SmPrx27a_10)
DNA ref. Phytozome 12:   scaffold_10 (449656..450857)
mRNA ref. JGI transcript:   89861
Protein sequence: SmPrx27-1_10 (SmPrx27a_10)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   332 (311)
PWM (Da):   %s   35968.18 (33869.0)  
PI (pH):   %s   6.35 (6.04) Peptide Signal:   %s   cut: 22 range:22-332
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAARLSLLACCLLGLITATIAQISLQCPPAEAIIRDTVFQNFLKDPTSPAGLLRLHFHDCFVEGCDASVMLESTPTDGTDVERFADGNNNSVRGFEIIDEAKTRIEAVCPGVVSCADIIAVAARDSSVILGGLFYQVPTGRYDGRVSNRTLANERLASPFENIDQLKRKFANVGLSTQDLVLLSGGHTIGRTKCRFFENRLYNFTGGLPDPRLNAEYAAALRRICTPQGADPCPTVALDRNSEFSFDNAYFRNLVANNGVLNSDHVLVESSETSGLVRNLAQDPNLFKVLFAESMINMGNAAWKTRANGEIRRKCSAVNTRLTTEVGHIAAV

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCACGGCTCTCTCTTCTTGCATGCTGTTTGCTCGGTTTGATCACCGCCACCATCGCCCAAATCAGCTTGCAATGCCCCCCGGCCGAGGCGATCATCCGCGACACCGTCTTCCAA
AACTTCCTCAAGGACCCGACCTCTCCAGCGGGCCTCCTGCGCTTACACTTCCACGATTGCTTTGTCGAA
GTAAGTTCTCTTCACTGATCCATACTTGGCTCTTTTTCTCGCCGTTTCTTT
GATCCATAACTTTCGTCTTCCAGGGATGCGATGCTTCAGTGATGCTCGAATCCACTCCCACTGACGGGACAGACGTCGAGAGATTCGCTGACGGGAACAATAACTCCGTTCGTGGATTCG
AAATCATCGACGAGGCCAAGACGAGGATCGAGGCCGTGTGTCCGGGAGTTGTGAGCTGCGCTGATATCATCGCCGTAGCAGCCAGAGATTCGTCCGTCATT
GTAAGAAAGCTTTTCCTCC
AGAGTGGTGTAGTGTTCCTGGCTTGGCTTGACCCCTGGTCTTCTTTGTCAGCTCGGAGGATTGTTCTATCAGGTTCCAACCGGAAGGTACGATGGAAGAGTTTCCAACAGGACGCTCGCC
AATGAGAGACTGGCTAGCCCATTCGAAAACATCGACCAGCTGAAGCGAAAATTCGCAAACGTTGGATTGTCTACTCAGGACCTCGTCCTTCTTTCCG
GTAAGTTGTTCTTCCAAGCCCCT
ATTTGCCTGTTTCCTGACCCAAGCTTTAATCTCTAGGTGGCCACACTATCGGTCGAACAAAGTGCCGCTTCTTCGAGAACCGTCTCTACAACTTCACTGGTGGACTGCCGGATCCCAGGC
TGAATGCCGAGTACGCTGCTGCGCTCCGACGGATTTGCACTCCACAGGGAGCAGACCCATGCCCGACAGTGGCCCTGGACAGAAACTCCGAGTTTAGCTTCGACAACGCCTACTTCAGGA
ACCTGGTCGCGAACAATGGTGTACTGAACTCCGACCACGTCCTTGTTGAGAGCTCTGAGACATCCGGCCTCGTGAGGAATCTAGCTCAGGATCCCAACCTGTTCAAGGTTTTATTCGCGG
AGTCCATGATCAACATGGGAAATGCTGCCTGGAAGACCCGAGCCAACGGAGAAATCAGAAGGAAGTGTAGCGCTGTAAACACGAGGCTTACCACCGAGGTCGGACACATAGCAGCCGTCT
AA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCACGGCTCTCTCTTCTTGCATGCTGTTTGCTCGGTTTGATCACCGCCACCATCGCCCAAATCAGCTTGCAATGCCCCCCGGCCGAGGCGATCATCCGCGACACCGTCTTCCAA
AACTTCCTCAAGGACCCGACCTCTCCAGCGGGCCTCCTGCGCTTACACTTCCACGATTGCTTTGTCGAA
GGATGCGATGCTTCAGTGATGCTCGAATCCACTCCCACTGACGGGACAGAC
GTCGAGAGATTCGCTGACGGGAACAATAACTCCGTTCGTGGATTCGAAATCATCGACGAGGCCAAGACGAGGATCGAGGCCGTGTGTCCGGGAGTTGTGAGCTGCGCTGATATCATCGCC
GTAGCAGCCAGAGATTCGTCCGTCATT
CTCGGAGGATTGTTCTATCAGGTTCCAACCGGAAGGTACGATGGAAGAGTTTCCAACAGGACGCTCGCCAATGAGAGACTGGCTAGCCCATTC
GAAAACATCGACCAGCTGAAGCGAAAATTCGCAAACGTTGGATTGTCTACTCAGGACCTCGTCCTTCTTTCCG
GTGGCCACACTATCGGTCGAACAAAGTGCCGCTTCTTCGAGAACCGT
CTCTACAACTTCACTGGTGGACTGCCGGATCCCAGGCTGAATGCCGAGTACGCTGCTGCGCTCCGACGGATTTGCACTCCACAGGGAGCAGACCCATGCCCGACAGTGGCCCTGGACAGA
AACTCCGAGTTTAGCTTCGACAACGCCTACTTCAGGAACCTGGTCGCGAACAATGGTGTACTGAACTCCGACCACGTCCTTGTTGAGAGCTCTGAGACATCCGGCCTCGTGAGGAATCTA
GCTCAGGATCCCAACCTGTTCAAGGTTTTATTCGCGGAGTCCATGATCAACATGGGAAATGCTGCCTGGAAGACCCGAGCCAACGGAGAAATCAGAAGGAAGTGTAGCGCTGTAAACACG
AGGCTTACCACCGAGGTCGGACACATAGCAGCCGTCTAA

Retrieve as FASTA