Entry information : SmPrx27-2_14 (SmPrx27b_14)
Entry ID 6995
Creation 2009-10-01 (Paula Nunes)
Last sequence changes 2009-10-01 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx27-2_14 (SmPrx27b_14)
Name (synonym) SmPrx27-2_14 (SmPrx27b_14)
Class Class III peroxidase    [Orthogroup: Prx047]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx27-2_14
start..stop
S start..stop
SmPrx27-1_10 662 0 1..332 1..332
SmPrx06-2_11 403 1e-141 27..331 35..338
SmPrx05-1_110 401 6e-141 6..331 3..335
SmPrx05-2_11 398 7e-140 26..331 31..335
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1734912..1735100 189 N° 2 1735175..1735372 198 N° 3 1735443..1735608 166 N° 4 1735668..1736113 446
join(1734912..1735100,1735175..1735372,1735443..1735608,1735668..1736113)


exon

Literature and cross-references SmPrx27-2_14 (SmPrx27b_14)
DNA ref. Phytozome 12:   scaffold_14 (1734912..1736113)
mRNA ref. JGI transcript:   93449
EST ref. GenBank:   FE461796.1 [5' end]   FE461797.1 [3' end]
Protein sequence: SmPrx27-2_14 (SmPrx27b_14)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   332 (311)
PWM (Da):   %s   35858.09 (33803.0) Transmb domain:   %s   i5-24o
PI (pH):   %s   6.04 (5.71) Peptide Signal:   %s   cut: 22 range:22-332
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAARLSLVACCLLGLIAATIAQIGLQCPPAEASIRDTVFQNFLKDPTSPAGLLRLHFHDCFVEGCDASVMLESTPTDGTDVERFADGNDNSVRGFEIIDEAKTRIEAVCPGAVSCADIIAVAARDSSVILGGLFYQVPTGRYDGRVSNRTLANERLASPFENIDQLKRKFANVGLSTQDLVLLSGGHTIGRTKCRFFENRLYNFTGGLPDPRLNAEYAAALRRICTPQGADPSPTVALDRNSEFSFDNAYFRNLVANNGVLNSDHVLVESSETSGLVRFLAQDPNLFKVLFAESMINMGNAAWKTRANGEIRRKCSAVNTRLTTEVGHIAAV

Retrieve as FASTA  
Remarks Complete sequence from genomic ( 3 introns) and 2 ESTs (DNA??).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCACGGCTCTCTCTTGTTGCATGCTGTTTGCTCGGTTTGATCGCCGCCACCATCGCCCAAATCGGCTTGCAATGCCCCCCGGCCGAGGCGAGCATCCGCGACACCGTCTTCCAA
AACTTCCTCAAGGACCCGACCTCTCCAGCGGGCCTCCTGCGCTTACACTTCCACGATTGCTTTGTCGAA
GTAAGTTCTCTTCACTGATCCATACTTGGCTCTTTTTCTCGCCGTTTCTTT
GATCCATAACTTTCGTCCTCCAGGGATGCGATGCTTCAGTGATGCTCGAATCCACTCCCACTGACGGGACAGACGTCGAGAGATTCGCTGACGGGAACGATAACTCCGTTCGTGGATTCG
AGATCATCGACGAGGCCAAGACGAGGATCGAGGCCGTGTGTCCGGGAGCTGTGAGCTGCGCTGATATCATCGCCGTAGCAGCCAGAGATTCGTCCGTCATT
GTAAGAAAGCTTTTCCTCC
AGAGTCGTGTAGTGTTCCTGGCTTGGCTTGACCCCTGGTCTTCTTTGTCAGCTCGGAGGATTGTTCTATCAGGTACCAACCGGAAGGTACGATGGAAGAGTTTCCAACAGGACGCTCGCC
AATGAGAGACTGGCTAGCCCATTCGAAAACATCGACCAGTTGAAGCGAAAATTCGCAAACGTTGGATTGTCTACTCAGGACCTCGTCCTTCTTTCCG
GTAAGTTGTTCTTCCAAGCCCCT
ATTTGCCTGTTTCCTGACCCAAGCTTTAATCTCTAGGTGGCCACACTATCGGTCGAACAAAGTGCCGCTTCTTCGAGAACCGTCTCTACAACTTCACTGGTGGACTGCCGGATCCCAGGC
TGAATGCCGAGTACGCTGCTGCGCTCCGACGGATTTGCACTCCACAGGGAGCAGACCCAAGCCCGACAGTGGCCCTGGACAGAAACTCCGAGTTTAGCTTCGACAACGCCTACTTCAGGA
ACCTGGTCGCGAACAATGGTGTACTGAACTCCGACCACGTCCTTGTTGAGAGCTCTGAGACCTCCGGCCTCGTGAGGTTTCTTGCTCAGGATCCCAACCTGTTCAAGGTTTTATTCGCGG
AGTCCATGATCAACATGGGAAATGCTGCCTGGAAGACCCGAGCCAACGGAGAAATCAGAAGGAAGTGTAGCGCTGTAAACACGAGGCTTACCACCGAGGTCGGACACATTGCAGCCGTCT
AA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCACGGCTCTCTCTTGTTGCATGCTGTTTGCTCGGTTTGATCGCCGCCACCATCGCCCAAATCGGCTTGCAATGCCCCCCGGCCGAGGCGAGCATCCGCGACACCGTCTTCCAA
AACTTCCTCAAGGACCCGACCTCTCCAGCGGGCCTCCTGCGCTTACACTTCCACGATTGCTTTGTCGAA
GGATGCGATGCTTCAGTGATGCTCGAATCCACTCCCACTGACGGGACAGAC
GTCGAGAGATTCGCTGACGGGAACGATAACTCCGTTCGTGGATTCGAGATCATCGACGAGGCCAAGACGAGGATCGAGGCCGTGTGTCCGGGAGCTGTGAGCTGCGCTGATATCATCGCC
GTAGCAGCCAGAGATTCGTCCGTCATT
CTCGGAGGATTGTTCTATCAGGTACCAACCGGAAGGTACGATGGAAGAGTTTCCAACAGGACGCTCGCCAATGAGAGACTGGCTAGCCCATTC
GAAAACATCGACCAGTTGAAGCGAAAATTCGCAAACGTTGGATTGTCTACTCAGGACCTCGTCCTTCTTTCCG
GTGGCCACACTATCGGTCGAACAAAGTGCCGCTTCTTCGAGAACCGT
CTCTACAACTTCACTGGTGGACTGCCGGATCCCAGGCTGAATGCCGAGTACGCTGCTGCGCTCCGACGGATTTGCACTCCACAGGGAGCAGACCCAAGCCCGACAGTGGCCCTGGACAGA
AACTCCGAGTTTAGCTTCGACAACGCCTACTTCAGGAACCTGGTCGCGAACAATGGTGTACTGAACTCCGACCACGTCCTTGTTGAGAGCTCTGAGACCTCCGGCCTCGTGAGGTTTCTT
GCTCAGGATCCCAACCTGTTCAAGGTTTTATTCGCGGAGTCCATGATCAACATGGGAAATGCTGCCTGGAAGACCCGAGCCAACGGAGAAATCAGAAGGAAGTGTAGCGCTGTAAACACG
AGGCTTACCACCGAGGTCGGACACATTGCAGCCGTCTAA

Retrieve as FASTA