Entry information : SmPrx05-2_11 (SmPrx05b_11)
Entry ID 6998
Creation 2009-10-06 (Christophe Dunand)
Last sequence changes 2011-01-25 (Toky Ramarohetra (Scipio))
Sequence status complete
Reviewer Paula Nunes
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx05-2_11 (SmPrx05b_11)
Name (synonym) SmPrx05-2_11 (SmPrx05b_11)
Class Class III peroxidase    [Orthogroup: Prx047]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx05-2_11
start..stop
S start..stop
SmPrx05-1_110 671 0 1..336 1..336
SmPrx06-2_11 602 0 1..336 1..339
SmPrx06-1_110 591 0 1..336 1..339
SmPrx27-1_10 404 4e-142 3..335 6..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1228446..1228649 204 N° 2 1228187..1228384 198 N° 3 1227970..1228132 163 N° 4 1227473..1227918 446
complement(join(1227473..1227918,1227970..1228132,1228187..1228384,1228446..1228 649))


exon

Literature and cross-references SmPrx05-2_11 (SmPrx05b_11)
DNA ref. Phytozome 12:   scaffold_11 (1228649..1227473)
EST ref. GenBank:   FE469215.1 [3' end]
Protein sequence: SmPrx05-2_11 (SmPrx05b_11)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   336 (318)
PWM (Da):   %s   36101.88 (34312.0)  
PI (pH):   %s   6.87 (6.88) Peptide Signal:   %s   cut: 19 range:19-336
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASMQLLCLALLVAAACSASAPDSLHSYARSCPSAEQIVAATVKSAADWDPTAPAGIIRLFFHDCFVQGCDGSILLESTPTDGRDVEMFALGNNNSARGFDIIEAAKTRLEAVCPGVVSCADVLAFAARDATTYFGGMFYTVPTGRLDGRISSRTEANSLPGPASSFSRLRDIFRGKGLSVHDLVLLSGGHTIGRAKCRFVETRVYNFNNTGRPDPSLDATYREELRRICPQGANPSPTVALDRNSEFSFDNAYYRNLEANRGLLSSDAVLRTDPDAANLINSLAQNPPTFRSMFAQSMINMGNIEWKTRANGEIRKKCSVVNSRITTEVGDVASF

Retrieve as FASTA  
Remarks complete sequence from genomic (introns) and 10 ESTs (FE437036.1, FE510992.1, FE510991.1). Not predicted from JGI. Contig also contain SmPrx05b
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCAATGCAACTTCTCTGCCTTGCACTCCTCGTAGCAGCAGCTTGTTCTGCGTCTGCTCCCGATTCTCTTCACAGCTATGCTCGATCTTGTCCGAGCGCTGAACAGATAGTCGCG
GCCACTGTCAAGAGTGCAGCTGACTGGGATCCAACAGCACCAGCCGGGATTATCCGCTTGTTCTTCCATGACTGCTTTGTCCAG
GTAAGTTCATCGTCTAAGCTTTATGTATGTGAGTTG
TAACGAATGTGACTCATTTGTCCAGGGGTGCGATGGATCGATACTTTTGGAATCCACTCCTACTGATGGCAGAGATGTCGAGATGTTCGCGCTCGGGAACAACAACTCTGCTCGTGGTTT
CGATATTATCGAGGCCGCAAAAACTCGCCTGGAGGCTGTGTGCCCGGGAGTTGTGAGCTGTGCGGATGTGCTCGCTTTTGCTGCCAGGGACGCGACGACTTAC
GTATGATTTTCCCTTTT
TGACTTTGTTGCTCATCGCCGAGTCTGATTGATGTAGTTTGGAGGGATGTTCTACACGGTGCCAACGGGTCGCCTTGACGGACGAATCTCTAGCAGAACAGAAGCCAACAGCTTACCGGG
TCCCGCTTCCTCGTTCAGTCGGCTGAGAGACATCTTCAGGGGCAAAGGCTTGTCAGTTCATGACCTCGTGCTGCTCTCCG
GTAAGAAGCTTCTCTTGAAGCTAGAACTCTCCACTAACAT
TGCAATAACAGGCGGACACACCATTGGTCGCGCGAAGTGTAGATTCGTCGAGACTCGTGTTTACAACTTTAACAACACCGGACGTCCCGACCCAAGCCTGGACGCTACGTACCGTGAGGA
GCTCCGGCGGATTTGCCCGCAGGGAGCAAACCCGAGCCCGACGGTGGCGCTGGACAGGAACTCGGAGTTTAGCTTCGACAATGCTTACTACAGGAACCTCGAGGCCAACAGGGGGCTGCT
TTCGTCGGACGCGGTGCTCCGAACCGACCCGGACGCTGCCAATCTCATCAACTCGCTCGCTCAGAACCCGCCAACGTTCCGCTCCATGTTCGCGCAGTCGATGATCAACATGGGAAACAT
CGAGTGGAAGACGAGAGCCAACGGGGAGATAAGGAAGAAGTGCTCGGTCGTGAACTCCAGGATCACCACCGAAGTGGGAGACGTTGCGTCCTTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCAATGCAACTTCTCTGCCTTGCACTCCTCGTAGCAGCAGCTTGTTCTGCGTCTGCTCCCGATTCTCTTCACAGCTATGCTCGATCTTGTCCGAGCGCTGAACAGATAGTCGCG
GCCACTGTCAAGAGTGCAGCTGACTGGGATCCAACAGCACCAGCCGGGATTATCCGCTTGTTCTTCCATGACTGCTTTGTCCAG
GGGTGCGATGGATCGATACTTTTGGAATCCACTCCT
ACTGATGGCAGAGATGTCGAGATGTTCGCGCTCGGGAACAACAACTCTGCTCGTGGTTTCGATATTATCGAGGCCGCAAAAACTCGCCTGGAGGCTGTGTGCCCGGGAGTTGTGAGCTGT
GCGGATGTGCTCGCTTTTGCTGCCAGGGACGCGACGACTTAC
TTTGGAGGGATGTTCTACACGGTGCCAACGGGTCGCCTTGACGGACGAATCTCTAGCAGAACAGAAGCCAACAGCTTA
CCGGGTCCCGCTTCCTCGTTCAGTCGGCTGAGAGACATCTTCAGGGGCAAAGGCTTGTCAGTTCATGACCTCGTGCTGCTCTCCG
GCGGACACACCATTGGTCGCGCGAAGTGTAGATTC
GTCGAGACTCGTGTTTACAACTTTAACAACACCGGACGTCCCGACCCAAGCCTGGACGCTACGTACCGTGAGGAGCTCCGGCGGATTTGCCCGCAGGGAGCAAACCCGAGCCCGACGGTG
GCGCTGGACAGGAACTCGGAGTTTAGCTTCGACAATGCTTACTACAGGAACCTCGAGGCCAACAGGGGGCTGCTTTCGTCGGACGCGGTGCTCCGAACCGACCCGGACGCTGCCAATCTC
ATCAACTCGCTCGCTCAGAACCCGCCAACGTTCCGCTCCATGTTCGCGCAGTCGATGATCAACATGGGAAACATCGAGTGGAAGACGAGAGCCAACGGGGAGATAAGGAAGAAGTGCTCG
GTCGTGAACTCCAGGATCACCACCGAAGTGGGAGACGTTGCGTCCTTCTAG

Retrieve as FASTA