Entry information : SmPrx24-1_80 (SmPrx24a_80)
Entry ID 7011
Creation 2009-10-07 (Christophe Dunand)
Last sequence changes 2011-01-26 (Toky Ramarohetra)
Sequence status complete
Reviewer Paula Nunes
Last annotation changes 2011-01-26 (Toky Ramarohetra)
Peroxidase information: SmPrx24-1_80 (SmPrx24a_80)
Name (synonym) SmPrx24-1_80 (SmPrx24a_80)
Class Class III peroxidase    [Orthogroup: Prx228]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx24-1_80
start..stop
S start..stop
SmPrx65-2_30 580 0 1..327 1..326
SmPrx24-2_30 580 0 1..327 1..326
SmPrx52-1_16 322 6e-110 9..327 32..346
SmPrx52-2_1 320 3e-109 9..327 32..346
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 265508..265930 423 N° 2 265256..265421 166 N° 3 264807..265201 395  
complement(join(264807..265201,265256..265421,265508..265930))


exon

Literature and cross-references SmPrx24-1_80 (SmPrx24a_80)
DNA ref. Phytozome 12:   scaffold_80 (265930..264807)
mRNA ref. JGI transcript:   125791 [Incorrect prediction]
Protein sequence: SmPrx24-1_80 (SmPrx24a_80)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (305)
PWM (Da):   %s   34668.85 (32322.5)  
PI (pH):   %s   8.41 (8.41) Peptide Signal:   %s   cut: 23 range:23-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAGRISMLLLLLPVLVPVMIDAAAGGLTPGFYQQSCPNAESMTRSTVQRLTLLDPTLSAALVRLVFHDCQVQGCDGSILLATTKNQSFSPVTTSELASSNNFGIRRLDAIDRIKSVLEASCPGVVSCADIVVMAARDAIALSGGPTIPILTGRRDGTTASAKQADDSLFPPQTPLDRVLSVFQSQGLDTVDAVALLGGHTLGVSHCPSVVNRLYPRMDSSLPLGFGASLRLRCPATIPMNNLSIIANDFTNLAFDNRFYSDVIASTGVLTVDQQLASDPRTRGIVNQFAADRAAFFRAFARGFQKMSQLNVLTSNAGQVRRSCRTAN

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 2 and 3). No ESTs. Incorrect transcript from JGI (PS is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGGAAGAATCTCAATGCTGCTCCTGTTGCTTCCAGTTCTTGTTCCGGTGATGATCGATGCAGCAGCAGGAGGCCTGACCCCGGGATTCTATCAGCAGAGTTGTCCGAACGCCGAA
TCCATGACACGTTCCACAGTCCAGCGACTGACCCTGCTCGATCCAACTCTCTCCGCTGCGCTGGTCCGCCTAGTCTTCCACGATTGCCAAGTCCAGGGCTGCGATGGATCCATCCTTCTC
GCCACCACCAAAAATCAATCCTTCTCCCCGGTCACCACCAGCGAGCTCGCCTCCTCCAACAACTTTGGAATCCGGCGATTGGACGCCATCGACCGGATTAAGTCGGTGCTCGAGGCCTCC
TGCCCTGGCGTTGTGTCGTGCGCGGACATCGTCGTCATGGCTGCCCGGGACGCCATTGCTCTG
GTAAGACAACAAAAGTTTCCATCATTTCGGAAGAAAGAAAGAATGCGAAAGAGCTGA
CCATTCTGATCTCGCTTGGATTTTCACAGTCTGGAGGGCCGACGATACCGATCCTGACCGGCAGAAGAGATGGAACCACAGCCAGCGCCAAGCAAGCCGACGATTCTCTTTTCCCGCCAC
AAACTCCGCTCGATCGGGTGCTCTCCGTCTTCCAATCGCAAGGCCTCGACACGGTGGATGCAGTAGCGCTGCTCG
GTATTTCACACCTGCTCGACCTTCTTGCCCGTAATATCGTTCGAT
CTTGCGCAGGAGGCCACACCCTGGGAGTGTCGCACTGCCCTAGCGTCGTCAATCGCCTCTACCCGCGCATGGATTCGTCGCTGCCGCTGGGATTCGGCGCGTCGCTGCGCCTGCGTTGCC
CGGCCACGATCCCGATGAACAACCTCAGCATCATCGCCAACGATTTCACAAACCTGGCCTTCGACAATCGCTTCTACAGCGATGTGATCGCCAGCACCGGCGTCCTCACGGTCGATCAGC
AGCTCGCCAGCGATCCGCGCACCCGCGGCATCGTCAATCAATTCGCCGCCGACCGCGCCGCCTTCTTCCGCGCATTCGCGCGAGGGTTCCAGAAAATGTCCCAGCTCAACGTGCTCACGA
GCAATGCCGGACAAGTACGGCGGAGCTGCCGTACAGCCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGGAAGAATCTCAATGCTGCTCCTGTTGCTTCCAGTTCTTGTTCCGGTGATGATCGATGCAGCAGCAGGAGGCCTGACCCCGGGATTCTATCAGCAGAGTTGTCCGAACGCCGAA
TCCATGACACGTTCCACAGTCCAGCGACTGACCCTGCTCGATCCAACTCTCTCCGCTGCGCTGGTCCGCCTAGTCTTCCACGATTGCCAAGTCCAGGGCTGCGATGGATCCATCCTTCTC
GCCACCACCAAAAATCAATCCTTCTCCCCGGTCACCACCAGCGAGCTCGCCTCCTCCAACAACTTTGGAATCCGGCGATTGGACGCCATCGACCGGATTAAGTCGGTGCTCGAGGCCTCC
TGCCCTGGCGTTGTGTCGTGCGCGGACATCGTCGTCATGGCTGCCCGGGACGCCATTGCTCTG
TCTGGAGGGCCGACGATACCGATCCTGACCGGCAGAAGAGATGGAACCACAGCCAGC
GCCAAGCAAGCCGACGATTCTCTTTTCCCGCCACAAACTCCGCTCGATCGGGTGCTCTCCGTCTTCCAATCGCAAGGCCTCGACACGGTGGATGCAGTAGCGCTGCTCG
GAGGCCACACC
CTGGGAGTGTCGCACTGCCCTAGCGTCGTCAATCGCCTCTACCCGCGCATGGATTCGTCGCTGCCGCTGGGATTCGGCGCGTCGCTGCGCCTGCGTTGCCCGGCCACGATCCCGATGAAC
AACCTCAGCATCATCGCCAACGATTTCACAAACCTGGCCTTCGACAATCGCTTCTACAGCGATGTGATCGCCAGCACCGGCGTCCTCACGGTCGATCAGCAGCTCGCCAGCGATCCGCGC
ACCCGCGGCATCGTCAATCAATTCGCCGCCGACCGCGCCGCCTTCTTCCGCGCATTCGCGCGAGGGTTCCAGAAAATGTCCCAGCTCAACGTGCTCACGAGCAATGCCGGACAAGTACGG
CGGAGCTGCCGTACAGCCAACTAA

Retrieve as FASTA