Entry information : SmPrx25-2_30 (SmPrx25b_30)
Entry ID 7012
Creation 2009-10-07 (Christophe Dunand)
Last sequence changes 2009-10-07 (Christophe Dunand)
Sequence status complete
Reviewer Paula Nunes
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx25-2_30 (SmPrx25b_30)
Name (synonym) SmPrx25-2_30 (SmPrx25b_30)
Class Class III peroxidase    [Orthogroup: Prx279]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx25-2_30
start..stop
S start..stop
SmPrx25-1_80 655 0 1..321 1..321
SmPrx52-1_16 389 2e-136 1..321 26..346
SmPrx52-2_1 388 5e-136 1..321 26..346
SmPrx12-2_55 347 6e-120 4..321 5..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1430149..1430358 210 N° 2 1429728..1430082 355 N° 3 1429257..1429657 401  
complement(join(1429257..1429657,1429728..1430082,1430149..1430358))


exon

Literature and cross-references SmPrx25-2_30 (SmPrx25b_30)
DNA ref. Phytozome 12:   scaffold_30 (1430358..1429257)
mRNA ref. JGI transcript:   105029 [Incorrect prediction]
EST ref. GenBank:   FE433121.1 [5' end]   FE430645.1 [3' end]
Protein sequence: SmPrx25-2_30 (SmPrx25b_30)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (298)
PWM (Da):   %s   33899.09 (31255.8)  
PI (pH):   %s   5.29 (5.62) Peptide Signal:   %s   cut: 24 range:24-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDLWLSAFWFWLTLSGLLSGTMSQLRAGFYDLTCPRVESIVRTTMTPNLMADPTAAAALVRAAFHDCQVGGCDASILLTSAGAITSEQESDKNFGIRGLNVIDRVKTALEFWCPGVVSCADIVVLAARDAITMGGGPTIDVLLGRRDSRFASNAQADSSLPPATITVPAMLDMFKAKGITPEEGVALIGAHTIGVSHCVSFVNRLYPSRDSAMGLVYAGRLGLSCPTGNPVLINNLTVVANDNTNLIFDNQYFRDVSSGMGLLTIDAELGVHPATSGIVALYAQNQKAFFDAFTAGFLKLTSHTVLTGDSGEIRRSCGSLN

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 3) and ESTs to confirm the polymorphism. Incorrect transcript prediction (PS is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCTCTGGTTGTCTGCATTCTGGTTTTGGCTTACTTTGAGTGGCTTGCTGTCGGGAACAATGTCACAGCTGAGAGCCGGCTTCTACGATCTCACTTGCCCTCGAGTGGAGAGCATT
GTTCGAACGACAATGACTCCGAACTTGATGGCGGATCCCACTGCAGCGGCGGCACTCGTTCGAGCAGCATTCCACGACTGCCAAGTTGGA
GTAAGTCTGTTTTTGTATAACGCTATCTAT
ATACCGGTATTGATCTGGGCTTGTTTCGTGACGCAGGGCTGTGACGCATCGATTCTTCTAACTTCGGCTGGAGCAATCACCAGCGAGCAGGAGTCTGACAAGAACTTTGGAATTCGGGGG
CTGAATGTGATCGACAGGGTAAAGACTGCTCTTGAGTTCTGGTGTCCCGGAGTGGTGTCGTGCGCGGACATAGTGGTCCTGGCCGCCCGGGATGCGATCACTATGGGAGGAGGTCCGACC
ATAGATGTGTTACTAGGCAGGAGGGACAGCCGGTTTGCAAGCAATGCTCAAGCAGACAGTTCTCTTCCACCGGCAACCATCACAGTTCCGGCAATGCTCGACATGTTCAAGGCGAAAGGC
ATCACTCCGGAGGAAGGTGTTGCTCTCATAG
GTGAGTCGAGCTTTTCCTTTTTCTAAATAGAAATTGTTCCTGATAAAATGAGTGAATGATCTTCTTCTAGGTGCTCATACAATCGGAGT
GTCACACTGCGTGAGCTTCGTGAATCGCTTATATCCCAGTAGGGACTCGGCAATGGGATTGGTGTACGCTGGAAGGTTGGGCTTGAGCTGCCCGACTGGAAACCCCGTACTCATCAACAA
CTTAACCGTGGTAGCCAACGATAACACCAATCTCATCTTCGACAACCAGTACTTCCGGGACGTGAGCAGCGGAATGGGGCTGCTGACGATCGACGCGGAGCTGGGAGTGCATCCAGCGAC
GTCCGGGATTGTCGCCCTCTACGCCCAGAACCAAAAGGCCTTCTTCGACGCTTTCACCGCGGGGTTCCTCAAGCTCACGTCTCACACGGTGCTCACCGGCGACAGTGGCGAGATACGACG
AAGCTGTGGATCTCTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCTCTGGTTGTCTGCATTCTGGTTTTGGCTTACTTTGAGTGGCTTGCTGTCGGGAACAATGTCACAGCTGAGAGCCGGCTTCTACGATCTCACTTGCCCTCGAGTGGAGAGCATT
GTTCGAACGACAATGACTCCGAACTTGATGGCGGATCCCACTGCAGCGGCGGCACTCGTTCGAGCAGCATTCCACGACTGCCAAGTTGGA
GGCTGTGACGCATCGATTCTTCTAACTTCG
GCTGGAGCAATCACCAGCGAGCAGGAGTCTGACAAGAACTTTGGAATTCGGGGGCTGAATGTGATCGACAGGGTAAAGACTGCTCTTGAGTTCTGGTGTCCCGGAGTGGTGTCGTGCGCG
GACATAGTGGTCCTGGCCGCCCGGGATGCGATCACTATGGGAGGAGGTCCGACCATAGATGTGTTACTAGGCAGGAGGGACAGCCGGTTTGCAAGCAATGCTCAAGCAGACAGTTCTCTT
CCACCGGCAACCATCACAGTTCCGGCAATGCTCGACATGTTCAAGGCGAAAGGCATCACTCCGGAGGAAGGTGTTGCTCTCATAG
GTGCTCATACAATCGGAGTGTCACACTGCGTGAGC
TTCGTGAATCGCTTATATCCCAGTAGGGACTCGGCAATGGGATTGGTGTACGCTGGAAGGTTGGGCTTGAGCTGCCCGACTGGAAACCCCGTACTCATCAACAACTTAACCGTGGTAGCC
AACGATAACACCAATCTCATCTTCGACAACCAGTACTTCCGGGACGTGAGCAGCGGAATGGGGCTGCTGACGATCGACGCGGAGCTGGGAGTGCATCCAGCGACGTCCGGGATTGTCGCC
CTCTACGCCCAGAACCAAAAGGCCTTCTTCGACGCTTTCACCGCGGGGTTCCTCAAGCTCACGTCTCACACGGTGCTCACCGGCGACAGTGGCGAGATACGACGAAGCTGTGGATCTCTC
AACTGA

Retrieve as FASTA