Entry information : SmPrx55-2_1 (SmPrx55b_1)
Entry ID 7022
Creation 2009-10-08 (Paula Nunes)
Last sequence changes 2009-10-08 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx55-2_1 (SmPrx55b_1)
Name (synonym) SmPrx55-2_1 (SmPrx55b_1)
Class Class III peroxidase    [Orthogroup: Prx029]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx55-2_1
start..stop
S start..stop
SmPrx55-1_5 671 0 1..335 1..335
SmPrx52-2_1 400 2e-140 26..334 40..346
SmPrx52-1_16 399 4e-140 30..334 45..346
ApuncPrx14 353 2e-122 38..334 19..314
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 5903489..5903737 249 N° 2 5903797..5904151 355 N° 3 5904217..5904620 404  
join(5903489..5903737,5903797..5904151,5904217..5904620)


exon

Literature and cross-references SmPrx55-2_1 (SmPrx55b_1)
DNA ref. Phytozome 12:   scaffold_1 (5903489..5904620)
mRNA ref. JGI transcript:   140930
Protein sequence: SmPrx55-2_1 (SmPrx55b_1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   335 (314)
PWM (Da):   %s   36108.35 (33833.1)  
PI (pH):   %s   7.22 (6.74) Peptide Signal:   %s   cut: 22 range:22-335
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTRQTLVLLVCSVFLLGLSNSEYYSVDTFGGNGFSKGLRFGFYAATCPKVETIVRESFTSNIFRDPTAAGALIRLAFHDCQVGGCDASILLSSSDSITSELVSDRNFGIRRLDFIDSIKSSLEASCPGVVSCADIIALAARDSIRISGGPNIPILLGRRDSTSASNLAADRSIPLPTISVDDTISLFQSKGMTLQETVAILGAHTVGVGHCVSVLDRLYPTQDPNLLPPRSAQLRAQCPPTPPQLLNNNTFFANDFTNVFFDNQYFRDILNGQGLFGIDSKIALDKRTSRIVSMFATNQAYFFAVFSSAFNKMLASNVLTGSSGEIRRDCKVVNS

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 3). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACACGGCAAACGCTAGTTCTTCTCGTCTGCTCGGTGTTTTTACTCGGCCTGTCCAACTCGGAGTACTACTCAGTCGACACTTTCGGTGGTAACGGGTTTTCAAAAGGACTGAGGTTT
GGATTCTATGCAGCTACTTGTCCAAAAGTGGAAACCATTGTCCGGGAGTCTTTCACTAGCAATATCTTTCGAGACCCGACTGCTGCCGGTGCTCTCATTCGTTTGGCGTTCCACGATTGC
CAAGTCGGG
GTACGTAGATGTTTTCCTCCAATCTTAACAGTTTTGGCCAACTTTCTGTGCTTCTCCAGGGCTGTGACGCGTCCATCCTGCTCAGCTCCTCCGACTCGATCACCAGCGAGC
TCGTCTCCGATAGAAACTTTGGAATCCGTCGACTGGATTTCATTGACAGCATCAAGAGCTCGCTCGAAGCGTCGTGCCCGGGTGTGGTTTCCTGTGCGGACATCATAGCCTTGGCTGCAA
GAGACTCCATCAGGATCTCGGGGGGACCAAACATTCCCATACTCCTGGGACGAAGGGACTCCACAAGCGCCAGTAACTTAGCGGCCGATCGATCCATTCCACTCCCAACTATCAGCGTCG
ACGACACCATCAGCCTGTTCCAGTCCAAAGGCATGACGCTCCAAGAAACAGTGGCCATTCTAG
GTACTCCTACTTCCAAATTCCCACTGCTGCTCCAGCTCTTTTCTTCGCTCTTTTCTT
GTTTGTAGGTGCTCACACTGTTGGTGTTGGCCACTGCGTAAGCGTCCTGGATCGACTGTATCCAACGCAAGACCCCAACTTGCTCCCTCCTCGCTCAGCGCAGCTCCGAGCTCAGTGTCC
TCCCACGCCGCCACAGCTCCTCAACAACAACACCTTCTTCGCCAATGACTTCACCAACGTGTTCTTCGACAACCAGTACTTCCGAGACATTCTCAATGGGCAGGGGCTGTTTGGAATCGA
CTCAAAGATCGCGCTTGACAAGAGAACCTCCCGGATTGTCTCCATGTTTGCGACGAACCAGGCGTACTTCTTTGCGGTCTTCTCCTCGGCGTTTAATAAGATGCTGGCGTCCAACGTTCT
CACGGGTAGCAGTGGAGAGATTAGAAGAGATTGCAAGGTTGTCAACTCGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACACGGCAAACGCTAGTTCTTCTCGTCTGCTCGGTGTTTTTACTCGGCCTGTCCAACTCGGAGTACTACTCAGTCGACACTTTCGGTGGTAACGGGTTTTCAAAAGGACTGAGGTTT
GGATTCTATGCAGCTACTTGTCCAAAAGTGGAAACCATTGTCCGGGAGTCTTTCACTAGCAATATCTTTCGAGACCCGACTGCTGCCGGTGCTCTCATTCGTTTGGCGTTCCACGATTGC
CAAGTCGGG
GGCTGTGACGCGTCCATCCTGCTCAGCTCCTCCGACTCGATCACCAGCGAGCTCGTCTCCGATAGAAACTTTGGAATCCGTCGACTGGATTTCATTGACAGCATCAAGAGC
TCGCTCGAAGCGTCGTGCCCGGGTGTGGTTTCCTGTGCGGACATCATAGCCTTGGCTGCAAGAGACTCCATCAGGATCTCGGGGGGACCAAACATTCCCATACTCCTGGGACGAAGGGAC
TCCACAAGCGCCAGTAACTTAGCGGCCGATCGATCCATTCCACTCCCAACTATCAGCGTCGACGACACCATCAGCCTGTTCCAGTCCAAAGGCATGACGCTCCAAGAAACAGTGGCCATT
CTAG
GTGCTCACACTGTTGGTGTTGGCCACTGCGTAAGCGTCCTGGATCGACTGTATCCAACGCAAGACCCCAACTTGCTCCCTCCTCGCTCAGCGCAGCTCCGAGCTCAGTGTCCTCCC
ACGCCGCCACAGCTCCTCAACAACAACACCTTCTTCGCCAATGACTTCACCAACGTGTTCTTCGACAACCAGTACTTCCGAGACATTCTCAATGGGCAGGGGCTGTTTGGAATCGACTCA
AAGATCGCGCTTGACAAGAGAACCTCCCGGATTGTCTCCATGTTTGCGACGAACCAGGCGTACTTCTTTGCGGTCTTCTCCTCGGCGTTTAATAAGATGCTGGCGTCCAACGTTCTCACG
GGTAGCAGTGGAGAGATTAGAAGAGATTGCAAGGTTGTCAACTCGTAA

Retrieve as FASTA