Entry information : SmPrx58-2_33 (SmPrx58b_33)
Entry ID 7025
Creation 2009-10-08 (Paula Nunes)
Last sequence changes 2009-10-08 (Paula Nunes)
Sequence status complete
Reviewer Bruno Savelli
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx58-2_33 (SmPrx58b_33)
Name (synonym) SmPrx58-2_33 (SmPrx58b_33)
Class Class III peroxidase    [Orthogroup: Prx077]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx58-2_33
start..stop
S start..stop
SmPrx58-1_129 634 0 1..315 1..315
SmPrx89-1_24 623 0 1..315 4..318
SmPrx93-2_26 621 0 1..315 4..318
SmPrx89-2_26 617 0 1..315 4..318
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1254110..1254304 195 N° 2 1253866..1254048 183 N° 3 1253247..1253816 570  
complement(join(1253247..1253816,1253866..1254048,1254110..1254304))


exon

Literature and cross-references SmPrx58-2_33 (SmPrx58b_33)
DNA ref. Phytozome 12:   scaffold_33 (1254304..1253247)
mRNA ref. JGI transcript:   106421
Protein sequence: SmPrx58-2_33 (SmPrx58b_33)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   315 (298)
PWM (Da):   %s   33537.57 (31815.6)  
PI (pH):   %s   7.99 (7.98) Peptide Signal:   %s   cut: 18 range:18-315
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSFVLVLLLALHGSALGQTLSSSFYRSSCPNLTTIVRAAVQQAVQAEARIAASFVRLHFHDCFVNGCDASILLDGANLEQNAFPNAGSARGFDIVDSIKSSVESSCPGVVSCADLLALIARDSVVALNGPSWTVVFGRRDSLTASQSAANSNLPPPTLNASALIASFQNQGLSTRDMVALSGAHTIGQAQCTTFKARLYGPFQRGDQMDQSFNTSLQSSCPSSNGDTNLSPLDVQTPTSFDNRYFRNLQNRRGLLFSDQTLFSGGQASTRNLVNSYALSQNTFFQDFGNAMVRMGNINVLTGSNGEIRRNCGRTN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTTTGTGCTTGTGTTGTTACTGGCTCTGCATGGAAGTGCTCTTGGCCAAACTTTGAGCTCCAGCTTCTACCGCTCCTCGTGCCCAAATCTCACCACCATCGTGAGAGCTGCAGTG
CAGCAGGCCGTCCAGGCAGAGGCTCGAATCGCAGCCTCGTTTGTTCGCCTCCATTTCCACGACTGCTTTGTCAAT
GTAGAAAGCTTCCATAAGTTTCATTCAAGCATATTGAAAGAACCA
TGCATTTCTCTTGCAGGGATGTGATGCTTCCATTCTTCTAGACGGCGCAAACCTGGAGCAAAACGCGTTTCCAAACGCTGGCTCCGCCCGTGGCTTCGACATCGTCGACTCCATCAAGAG
CTCCGTCGAGAGCTCCTGCCCGGGTGTTGTCTCCTGCGCTGACTTACTGGCGCTCATTGCCCGGGACTCCGTAGTCGCG
GTAAACTCTCAAAGTCAACGGTCAAAAGCTTACAATATCGT
TTTTACAGCTGAACGGGCCTTCGTGGACGGTGGTGTTTGGAAGGAGGGATAGCTTAACAGCAAGCCAATCCGCTGCAAATTCCAACCTTCCTCCTCCAACTTTGAATGCCTCAGCGCTCA
TCGCGAGTTTCCAAAACCAGGGGCTTTCAACCAGAGATATGGTGGCTCTCTCTGGGGCTCACACCATTGGGCAGGCCCAGTGCACCACCTTTAAGGCTCGGCTCTACGGGCCCTTCCAAA
GAGGGGACCAGATGGATCAAAGTTTTAACACCTCGTTGCAAAGCTCGTGCCCGAGCAGCAATGGCGACACCAATCTCTCGCCGCTCGACGTCCAGACGCCGACCAGCTTTGACAATCGCT
ACTTTAGGAACTTGCAGAACCGGAGAGGGTTGCTTTTCTCGGACCAGACGCTCTTTTCCGGGGGTCAGGCCAGCACGAGGAATCTCGTCAACTCGTACGCTTTGAGCCAGAACACTTTCT
TCCAGGACTTTGGCAATGCCATGGTAAGGATGGGCAATATCAATGTGTTGACTGGATCCAATGGAGAGATTCGAAGAAACTGTGGAAGAACAAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCTTTGTGCTTGTGTTGTTACTGGCTCTGCATGGAAGTGCTCTTGGCCAAACTTTGAGCTCCAGCTTCTACCGCTCCTCGTGCCCAAATCTCACCACCATCGTGAGAGCTGCAGTG
CAGCAGGCCGTCCAGGCAGAGGCTCGAATCGCAGCCTCGTTTGTTCGCCTCCATTTCCACGACTGCTTTGTCAAT
GGATGTGATGCTTCCATTCTTCTAGACGGCGCAAACCTGGAGCAA
AACGCGTTTCCAAACGCTGGCTCCGCCCGTGGCTTCGACATCGTCGACTCCATCAAGAGCTCCGTCGAGAGCTCCTGCCCGGGTGTTGTCTCCTGCGCTGACTTACTGGCGCTCATTGCC
CGGGACTCCGTAGTCGCG
CTGAACGGGCCTTCGTGGACGGTGGTGTTTGGAAGGAGGGATAGCTTAACAGCAAGCCAATCCGCTGCAAATTCCAACCTTCCTCCTCCAACTTTGAATGCC
TCAGCGCTCATCGCGAGTTTCCAAAACCAGGGGCTTTCAACCAGAGATATGGTGGCTCTCTCTGGGGCTCACACCATTGGGCAGGCCCAGTGCACCACCTTTAAGGCTCGGCTCTACGGG
CCCTTCCAAAGAGGGGACCAGATGGATCAAAGTTTTAACACCTCGTTGCAAAGCTCGTGCCCGAGCAGCAATGGCGACACCAATCTCTCGCCGCTCGACGTCCAGACGCCGACCAGCTTT
GACAATCGCTACTTTAGGAACTTGCAGAACCGGAGAGGGTTGCTTTTCTCGGACCAGACGCTCTTTTCCGGGGGTCAGGCCAGCACGAGGAATCTCGTCAACTCGTACGCTTTGAGCCAG
AACACTTTCTTCCAGGACTTTGGCAATGCCATGGTAAGGATGGGCAATATCAATGTGTTGACTGGATCCAATGGAGAGATTCGAAGAAACTGTGGAAGAACAAACTAG

Retrieve as FASTA