Entry information : SmPrx30-1_84 (SmPrx30a_84)
Entry ID 7026
Creation 2009-10-09 (Paula Nunes)
Last sequence changes 2009-10-09 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx30-1_84 (SmPrx30a_84)
Name (synonym) SmPrx30-1_84 (SmPrx30a_84)
Class Class III peroxidase    [Orthogroup: Prx047]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx30-1_84
start..stop
S start..stop
SmPrx30-2_131 692 0 1..335 1..335
SmPrx104-1_151 647 0 1..333 4..337
SmPrx104-2_171 645 0 1..333 4..337
SmPrx13-2_57 418 1e-147 29..331 34..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 118491..118703 213 N° 2 118236..118433 198 N° 3 117969..118131 163 N° 4 117474..117907 434
complement(join(117474..117907,117969..118131,118236..118433,118491..118703))


exon

Literature and cross-references SmPrx30-1_84 (SmPrx30a_84)
DNA ref. Phytozome 12:   scaffold_84 (118703..117474)
mRNA ref. JGI transcript:   126863
Protein sequence: SmPrx30-1_84 (SmPrx30a_84)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   335 (308)
PWM (Da):   %s   36817.4 (33904.7)  
PI (pH):   %s   8.57 (8.02) Peptide Signal:   %s   cut: 28 range:28-335
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAFPKRATVSILVVVFLSLISSRNVLASHSYARTCPNAESIIRDTINEHASRDPTIPAGLIRLHFHDCFVNGCDGSILLDSTPTDGTNVEKFAPPNRDSARGFEVIEDAKRRLEQACPGIVSCADTVAIAARDSTVKMGGQHYIVATGRYDGRVSSLQLATNIPSPSMDASTLIENFKNQGLSVQDLVVLSGAHTLGTSKCNFFASGRFDRLYNFRNTSRGDETVNPAYLQHLRNRCPREGSANTVELDKGSQFSFDNSYFKNLERRNGLLTSDQVLFESERTSGLVRSYAYNSRQFASHFGQSMVRMGSIGWKTKENGEIRTVCNAVNVNKHKL

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTTCCAAAGAGAGCAACAGTGTCAATACTAGTAGTAGTCTTTCTCTCTTTGATCAGCTCCAGGAATGTTTTGGCATCGCACAGCTACGCAAGAACTTGTCCAAATGCGGAGTCG
ATTATCAGAGACACGATCAATGAGCACGCTAGTCGGGACCCTACAATCCCCGCGGGACTGATTCGCTTGCACTTCCACGACTGCTTCGTGAAC
GTAAGCTAGCTACAAGATGAATTCACC
AGATTTCTCACCTTGCCTAAATCACTCCAGGGTTGCGATGGCTCCATCCTTCTCGACTCCACTCCAACAGACGGTACCAATGTCGAGAAATTCGCTCCTCCAAACCGGGACTCCGCCCGA
GGATTTGAAGTTATCGAGGATGCGAAAAGAAGGCTGGAACAGGCTTGCCCTGGTATAGTTTCCTGTGCCGACACTGTGGCCATCGCCGCAAGAGATTCAACCGTTAAG
GTTAGTTCCTGA
TTCATAGTGGAGTTTTCGCCCCTCCATCAAGCCATCTTTTTCTTCTTCTCCTACTTCTTCTTCTCCTCTCATATTTGGGTCTTGGATTATAGATGGGAGGCCAGCACTACATAGTAGCCA
CTGGACGTTACGATGGAAGAGTGTCGAGCTTGCAGCTGGCCACAAACATTCCATCACCATCCATGGACGCCTCGACTCTCATCGAAAATTTCAAGAACCAAGGCTTGTCCGTTCAAGACC
TTGTCGTTCTGTCAG
GTGAGATCACTCGACTTTCTTGCTGGATCCATTCACTCACGATCTCTTTTTAATTTTCCAGGAGCTCACACACTGGGAACCTCCAAATGCAACTTCTTCGCCAGT
GGCCGCTTCGACCGCCTCTACAACTTCAGAAACACGAGTAGGGGCGACGAGACGGTAAATCCCGCGTACTTGCAGCACCTCCGCAACAGATGCCCGCGCGAGGGGTCCGCAAACACGGTG
GAGCTTGACAAGGGCTCGCAATTCAGCTTTGACAACTCCTACTTCAAGAACTTGGAGCGGAGGAATGGACTTCTCACCTCTGACCAGGTGCTTTTCGAGAGTGAGCGCACGAGTGGACTT
GTGCGATCCTACGCGTACAATTCCAGGCAGTTTGCGTCGCATTTTGGGCAATCTATGGTAAGAATGGGAAGCATCGGGTGGAAGACGAAAGAGAATGGGGAGATTAGAACGGTGTGTAAT
GCCGTGAATGTAAATAAACACAAGTTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTTCCAAAGAGAGCAACAGTGTCAATACTAGTAGTAGTCTTTCTCTCTTTGATCAGCTCCAGGAATGTTTTGGCATCGCACAGCTACGCAAGAACTTGTCCAAATGCGGAGTCG
ATTATCAGAGACACGATCAATGAGCACGCTAGTCGGGACCCTACAATCCCCGCGGGACTGATTCGCTTGCACTTCCACGACTGCTTCGTGAAC
GGTTGCGATGGCTCCATCCTTCTCGAC
TCCACTCCAACAGACGGTACCAATGTCGAGAAATTCGCTCCTCCAAACCGGGACTCCGCCCGAGGATTTGAAGTTATCGAGGATGCGAAAAGAAGGCTGGAACAGGCTTGCCCTGGTATA
GTTTCCTGTGCCGACACTGTGGCCATCGCCGCAAGAGATTCAACCGTTAAG
ATGGGAGGCCAGCACTACATAGTAGCCACTGGACGTTACGATGGAAGAGTGTCGAGCTTGCAGCTGGCC
ACAAACATTCCATCACCATCCATGGACGCCTCGACTCTCATCGAAAATTTCAAGAACCAAGGCTTGTCCGTTCAAGACCTTGTCGTTCTGTCAG
GAGCTCACACACTGGGAACCTCCAAA
TGCAACTTCTTCGCCAGTGGCCGCTTCGACCGCCTCTACAACTTCAGAAACACGAGTAGGGGCGACGAGACGGTAAATCCCGCGTACTTGCAGCACCTCCGCAACAGATGCCCGCGCGAG
GGGTCCGCAAACACGGTGGAGCTTGACAAGGGCTCGCAATTCAGCTTTGACAACTCCTACTTCAAGAACTTGGAGCGGAGGAATGGACTTCTCACCTCTGACCAGGTGCTTTTCGAGAGT
GAGCGCACGAGTGGACTTGTGCGATCCTACGCGTACAATTCCAGGCAGTTTGCGTCGCATTTTGGGCAATCTATGGTAAGAATGGGAAGCATCGGGTGGAAGACGAAAGAGAATGGGGAG
ATTAGAACGGTGTGTAATGCCGTGAATGTAAATAAACACAAGTTGTAA

Retrieve as FASTA