Entry information : SmPrx34-2_131 (SmPrx34b_131)
Entry ID 7034
Creation 2009-10-13 (Christophe Dunand)
Last sequence changes 2009-10-13 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx34-2_131 (SmPrx34b_131)
Name (synonym) SmPrx34-2_131 (SmPrx34b_131)
Class Class III peroxidase    [Orthogroup: Prx078]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx34-2_131
start..stop
S start..stop
SmPrx34-1_84 671 0 1..328 1..328
SmPrx36-1_2 426 4e-150 16..328 66..375
SmPrx36-2_44 426 4e-150 16..328 66..375
CmichPrx01 390 1e-136 10..328 39..361
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 334905..335117 213 N° 2 334654..334845 192 N° 3 334009..334590 582  
complement(join(334009..334590,334654..334845,334905..335117))


exon

Literature and cross-references SmPrx34-2_131 (SmPrx34b_131)
DNA ref. Phytozome 12:   scaffold_131 (335117..334009)
mRNA ref. JGI transcript:   236494   430497   135053 [Incorrect prediction]
Protein sequence: SmPrx34-2_131 (SmPrx34b_131)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (304)
PWM (Da):   %s   35522.18 (33046.9) Transmb domain:   %s   i5-27o
PI (pH):   %s   8.76 (9.12) Peptide Signal:   %s   cut: 25 range:25-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSMVVVLLLLLPCALLCLFSCAAAQLTPDFYDKSCPTLIPTVRAVLQKAIAKEPRIAASLLRLHFHDCFVNGCDASLLLDDTPSFTGEKGAVPNNRSARGFRVVDRAKFAVEKSCPGVVSCADILAILARESVVLLDGPSWAVQLGRRDSTTANRSAANNEIPPPNSTLANLLSQFQAKGLNAQELVALSGSHTIGLSRCVSFRDRLYNFSGSGRPDSTLQPHFWEDLRAKCPRFHGNNVVAPLDAHTPLHFDNLYYHNLHASVGLLNSDQVLYSTSGPNSTRAIVTRYRDDQGAFFADFASAMVKMGNISPLTGTSGQIRKKCRRVN*

Retrieve as FASTA  
Remarks Sequence complete from genomic (introns 1 and 2). No EST
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGATGGTGGTGGTGCTGCTGCTGCTGCTGCCTTGCGCGTTGCTGTGCTTGTTCTCTTGTGCGGCAGCGCAGCTCACTCCAGATTTCTACGACAAATCCTGCCCAACCTTGATCCCC
ACTGTTCGTGCCGTGCTCCAGAAAGCCATTGCCAAGGAGCCCCGGATCGCTGCGTCGCTGCTACGCTTGCATTTCCACGACTGCTTCGTCAAT
GTAAGTGGCTCTTACGTAGTGCTCAAT
TCTTGGATCATCCATTTCTTCTGTCCATGCAGGGATGCGATGCTTCTTTGCTCTTGGACGACACTCCCAGTTTCACTGGCGAGAAAGGCGCGGTTCCAAACAACCGATCGGCGAGGGGCT
TTCGAGTGGTGGATCGAGCAAAGTTTGCAGTGGAGAAATCGTGCCCGGGAGTGGTATCGTGCGCGGACATTCTCGCCATCCTCGCACGCGAATCAGTCGTCCTG
GTAAGAATGCCAAGAA
CTTTCTTACACTTAAAACAGTGATCTTTCGATCGATCGGACTAACAGCTGGATGGACCGAGCTGGGCGGTGCAACTGGGCCGCCGCGATAGCACCACCGCCAACCGGAGCGCCGCCAACA
ACGAGATCCCACCACCGAATTCCACGCTCGCGAACCTTCTCTCCCAGTTCCAAGCCAAAGGTCTCAACGCGCAAGAGCTCGTCGCGCTCTCCGGATCCCACACCATCGGCCTCTCCCGCT
GCGTGAGCTTCCGCGATCGTCTCTACAACTTCTCTGGATCCGGGCGCCCCGATTCCACGCTCCAGCCACACTTTTGGGAAGATCTCCGCGCCAAATGCCCGCGTTTCCACGGCAACAACG
TCGTCGCGCCGCTCGACGCCCACACTCCACTCCACTTCGACAATCTCTACTACCACAATCTCCACGCCAGTGTGGGTCTGCTCAACTCCGATCAGGTGCTCTACTCCACTTCCGGGCCGA
ATTCCACGCGCGCCATCGTCACCAGGTACCGCGACGATCAAGGCGCCTTCTTCGCGGATTTCGCTAGCGCCATGGTGAAGATGGGAAACATCAGCCCGCTCACCGGCACCAGCGGCCAGA
TTCGCAAGAAATGCCGCCGAGTCAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCGATGGTGGTGGTGCTGCTGCTGCTGCTGCCTTGCGCGTTGCTGTGCTTGTTCTCTTGTGCGGCAGCGCAGCTCACTCCAGATTTCTACGACAAATCCTGCCCAACCTTGATCCCC
ACTGTTCGTGCCGTGCTCCAGAAAGCCATTGCCAAGGAGCCCCGGATCGCTGCGTCGCTGCTACGCTTGCATTTCCACGACTGCTTCGTCAAT
GGATGCGATGCTTCTTTGCTCTTGGAC
GACACTCCCAGTTTCACTGGCGAGAAAGGCGCGGTTCCAAACAACCGATCGGCGAGGGGCTTTCGAGTGGTGGATCGAGCAAAGTTTGCAGTGGAGAAATCGTGCCCGGGAGTGGTATCG
TGCGCGGACATTCTCGCCATCCTCGCACGCGAATCAGTCGTCCTG
CTGGATGGACCGAGCTGGGCGGTGCAACTGGGCCGCCGCGATAGCACCACCGCCAACCGGAGCGCCGCCAACAAC
GAGATCCCACCACCGAATTCCACGCTCGCGAACCTTCTCTCCCAGTTCCAAGCCAAAGGTCTCAACGCGCAAGAGCTCGTCGCGCTCTCCGGATCCCACACCATCGGCCTCTCCCGCTGC
GTGAGCTTCCGCGATCGTCTCTACAACTTCTCTGGATCCGGGCGCCCCGATTCCACGCTCCAGCCACACTTTTGGGAAGATCTCCGCGCCAAATGCCCGCGTTTCCACGGCAACAACGTC
GTCGCGCCGCTCGACGCCCACACTCCACTCCACTTCGACAATCTCTACTACCACAATCTCCACGCCAGTGTGGGTCTGCTCAACTCCGATCAGGTGCTCTACTCCACTTCCGGGCCGAAT
TCCACGCGCGCCATCGTCACCAGGTACCGCGACGATCAAGGCGCCTTCTTCGCGGATTTCGCTAGCGCCATGGTGAAGATGGGAAACATCAGCCCGCTCACCGGCACCAGCGGCCAGATT
CGCAAGAAATGCCGCCGAGTCAATTGA

Retrieve as FASTA