Entry information : SmPrx52-2_1 (SmPrx52b_1)
Entry ID 7040
Creation 2009-12-18 (Christophe Dunand)
Last sequence changes 2011-01-26 (Toky Ramarohetra)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-09-04 (Qiang Li)
Peroxidase information: SmPrx52-2_1 (SmPrx52b_1)
Name (synonym) SmPrx52-2_1 (SmPrx52b_1)
Class Class III peroxidase    [Orthogroup: Prx034]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx52-2_1
start..stop
S start..stop
SmPrx52-1_16 697 0 1..346 1..346
SmPrx[P]54a_16 509 0 96..346 1..251
SmPrx[P]53b_1 509 0 96..346 1..251
SmPrx[P]53a_16 509 0 96..346 1..251
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2613507..2613634 128 N° 2 2614280..2614436 157 N° 3 2614491..2614845 355 N° 4 2614922..2615322 401
join(2613507..2613634,2614280..2614436,2614491..2614845,2614922..2615322)


exon

Literature and cross-references SmPrx52-2_1 (SmPrx52b_1)
DNA ref. Phytozome 12:   scaffold_1 (2613507..2615322)
mRNA ref. JGI transcript:   77725 [Incorrect prediction]
Protein sequence: SmPrx52-2_1 (SmPrx52b_1)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   346
PWM (Da):   %s   36862.89  
PI (pH):   %s   8.74
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MNSLAAFFAALSGKYLARSLGGGARMKTYRGMLLLSVMLVATFSGGNSGLRIGFYSSSCPNAESIVRAAFSGNFITDPTAPAALLRLAFHDCQVGCDASILLDSKGSIKSERDSDKNFGIRRLDFIDRIKSMLEAACPGVVSCADIIVLVARESIVFTGGPTIPVLTGRRDGTAASNAAADRLLPPATVSVDNFISLFASKGLSLDESVAIIGAHTIGVGHCVNIVNRLYPNQDSKIGLLFASRLRVQCPTANPRMLNNITVINNDMTNLVFDNQYFRDLMNGQGLFTIDSELALDSRTSPVVARFSTNQQLFLDTFSSAFVKLTSSNVLTGQSGQVRKYCHSVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 3 and extra 5' intron ). No EST. Incorrect predict from JGI (Very long PS, repeated residus => intronic sequence predicted in constrained condition.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAACTCTCTAGCAGCATTCTTCGCTGCTCTTTCCGGCAAGTACTTAGCTCGATCATTAGGAGGAGGTGCTAGAATGAAGACTTACAGGGGAATGCTGCTCCTTTCAGTGATGCTAGTA
GCTACATT
GTCTTGGGCAGCAAGGGAAACAAGCGAAGTCATGGAACCGGCGCACCATTGTCCGGACCACGACGACGGCGATTATTACAGGTGCAGAGGTAGATTTAACGGGGGTGGAGGT
CCCAACATCGGTGATGGAAGTGGCGGTAACTTTGGTGGAGGCAACGGCGGTAACTTTGGTGGTGGTGGAGGAAACTTTGGAAACGGGGGAGGGCCTGGTTCCAACTTTGGGGGTGGAACT
GGGGGGAGCTTTGGAAATGGCGGTGGTGGCCCGGGTTCCAACTTCGGGGGTGGTGGAAGCTTTGGGAATGGAGGTGGTGGCCCGGGTTCCAACTTTGGAGGTGGTGGTCCGGGTTCCAAT
TTTGGAGGTGGAAGTGGAGGGAGTTTTGGCAATGGAGGTGGTCCGGGTTCGAACTTTGGTGGTGGAAGTGGAGGGAATTTTGGCAATGGAGGTGGTCCGGGTTCTAACTTTGGTGGTGGA
AGCGGAGGGAGTTTTGGCAGTCCTGGAGGGAACATCGGCAGTGGAGGAGGCAGCGGAATTGGTGGTGGAAGCGGAGGGAGTTTTGGCAGTCCTGGAGGGAACATCGGCAATGGAGGAGGC
AGTGGAATTGGTTTTGGTAGCCCGAATGCTGGCGGAGGTGATGCGTCTGGGAGCAGCGGTGGTAACTCAGGTCTAAGAATCGGTTTCTACTCGTCATCGTGTCCAAATGCGGAGAGCATT
GTGCGAGCTGCCTTCTCTGGAAATTTTATTACCGATCCAACAGCACCCGCAGCACTCCTTCGGCTGGCTTTTCACGACTGCCAAGTCGGG
GTAAGCATTTTTCTCGTTTCCTTTTCATGC
TTTTTTATACGTTTTGTTCTACAGGGTTGCGACGCGTCCATCTTGCTCGACTCGAAAGGTTCCATCAAAAGCGAGAGAGACTCGGACAAGAACTTTGGCATCCGCCGCTTGGATTTCATC
GACAGGATCAAGTCGATGCTGGAGGCTGCCTGTCCGGGAGTCGTCTCGTGCGCGGACATCATCGTTCTGGTGGCCAGAGAATCCATCGTCTTCACCGGAGGCCCGACAATCCCCGTGCTC
ACAGGAAGAAGAGATGGCACAGCCGCTTCCAACGCCGCAGCCGACAGGCTGTTGCCTCCAGCAACCGTAAGCGTCGACAACTTCATCAGCCTCTTCGCATCCAAGGGCCTCTCTCTCGAC
GAAAGCGTTGCAATCATCG
GTACGTTTCAAGGCTTTTCTTTCCAGCAAACTTTCCAAGGACGATTGATCCGAACTTCTGTACTTTTGCATTCCAGGAGCTCACACAATTGGAGTTGGGCA
CTGCGTCAACATTGTGAATCGGCTCTATCCAAACCAGGACAGTAAGATCGGCCTCCTGTTCGCGAGCCGGCTGAGAGTCCAGTGCCCGACGGCCAATCCCCGGATGCTCAACAACATTAC
AGTGATCAACAACGATATGACCAACCTCGTGTTTGACAACCAGTACTTCCGGGACCTTATGAACGGGCAGGGGCTCTTCACCATCGATTCGGAGCTTGCGCTGGACAGCCGCACGTCGCC
AGTGGTGGCGCGCTTCTCCACGAACCAGCAGCTCTTCCTCGACACATTCTCTTCGGCTTTCGTCAAGCTCACGTCCAGCAATGTCTTGACGGGACAGAGTGGACAGGTTCGAAAGTACTG
CCACTCGGTGAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAACTCTCTAGCAGCATTCTTCGCTGCTCTTTCCGGCAAGTACTTAGCTCGATCATTAGGAGGAGGTGCTAGAATGAAGACTTACAGGGGAATGCTGCTCCTTTCAGTGATGCTAGTA
GCTACATT
CAGCGGTGGTAACTCAGGTCTAAGAATCGGTTTCTACTCGTCATCGTGTCCAAATGCGGAGAGCATTGTGCGAGCTGCCTTCTCTGGAAATTTTATTACCGATCCAACAGCA
CCCGCAGCACTCCTTCGGCTGGCTTTTCACGACTGCCAAGTCGGG
GGTTGCGACGCGTCCATCTTGCTCGACTCGAAAGGTTCCATCAAAAGCGAGAGAGACTCGGACAAGAACTTTGGC
ATCCGCCGCTTGGATTTCATCGACAGGATCAAGTCGATGCTGGAGGCTGCCTGTCCGGGAGTCGTCTCGTGCGCGGACATCATCGTTCTGGTGGCCAGAGAATCCATCGTCTTCACCGGA
GGCCCGACAATCCCCGTGCTCACAGGAAGAAGAGATGGCACAGCCGCTTCCAACGCCGCAGCCGACAGGCTGTTGCCTCCAGCAACCGTAAGCGTCGACAACTTCATCAGCCTCTTCGCA
TCCAAGGGCCTCTCTCTCGACGAAAGCGTTGCAATCATCG
GAGCTCACACAATTGGAGTTGGGCACTGCGTCAACATTGTGAATCGGCTCTATCCAAACCAGGACAGTAAGATCGGCCTC
CTGTTCGCGAGCCGGCTGAGAGTCCAGTGCCCGACGGCCAATCCCCGGATGCTCAACAACATTACAGTGATCAACAACGATATGACCAACCTCGTGTTTGACAACCAGTACTTCCGGGAC
CTTATGAACGGGCAGGGGCTCTTCACCATCGATTCGGAGCTTGCGCTGGACAGCCGCACGTCGCCAGTGGTGGCGCGCTTCTCCACGAACCAGCAGCTCTTCCTCGACACATTCTCTTCG
GCTTTCGTCAAGCTCACGTCCAGCAATGTCTTGACGGGACAGAGTGGACAGGTTCGAAAGTACTGCCACTCGGTGAACTAG

Retrieve as FASTA