Entry information : SmPrx12-1_113 (SmPrx12a_113)
Entry ID 7044
Creation 2009-10-15 (Paula Nunes)
Last sequence changes 2009-10-15 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx12-1_113 (SmPrx12a_113)
Name (synonym) SmPrx12-1_113 (SmPrx12a_113)
Class Class III peroxidase    [Orthogroup: Prx203]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx12-1_113
start..stop
S start..stop
SmPrx12-2_55 666 0 1..326 1..326
SmPrx11-1_35 410 8e-145 9..326 14..332
SmPrx11-2_41 408 6e-144 9..326 14..332
SmPrx52-1_16 357 2e-123 10..326 31..346
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 20237..20458 222 N° 2 19425..20183 759  
complement(join(19425..20183,20237..20458))


exon

Literature and cross-references SmPrx12-1_113 (SmPrx12a_113)
DNA ref. Phytozome 12:   scaffold_113 (20458..19425)
mRNA ref. JGI transcript:   132762
Protein sequence: SmPrx12-1_113 (SmPrx12a_113)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (302)
PWM (Da):   %s   35026.6 (32433.3) Transmb domain:   %s   i5-27o
PI (pH):   %s   7.98 (7.98) Peptide Signal:   %s   cut: 25 range:25-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVNWGSNFAMWVILAMVLTLASSSSSQLSFGFYKKSCPGLESTVRSTIMSSLFGDPTAAAALLRLSFHDCQVGGCDASILLNNKGSITSEMVSDRNFGVRELAIIDRIKAAVDAQCGGGEVSCADIVALAGRDAAAIAGGPDFPIQLGRRDATFASNRAADAALPPPTISVDKFLEIFRAMGMSIEESVAIMGAHTLGVGHCLNIVNRLYPTLDSNLNPFYAARLRISCPVSDPRFILNTTTVMNDFTSLRFDNRYYQEVSSRLGLFSIDAALGQDSRTSTAVAKFAQDQNQFFQTYITAYQKLTAHKVLTGSSGQIRKNCRYVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (intron 1). No ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGTGAATTGGGGATCCAATTTCGCAATGTGGGTGATTCTAGCCATGGTCCTGACACTCGCAAGCTCGAGCTCCTCCCAGCTCTCGTTCGGTTTCTACAAGAAATCTTGCCCGGGG
CTGGAGAGCACGGTGAGATCGACGATCATGAGCAGCCTCTTTGGCGATCCCACCGCCGCGGCGGCGCTCCTCCGCCTCTCCTTCCACGACTGCCAAGTCGGG
GTAAGCTAGATAGACTTT
ATCGACGCTGACATCCTCGATCAATTTCCATCCAGGGCTGCGACGCATCGATCCTGCTCAACAACAAGGGCTCCATCACCAGCGAGATGGTGTCCGATCGAAATTTCGGCGTCCGGGAGC
TCGCGATCATCGATCGGATCAAGGCGGCGGTGGATGCGCAATGCGGCGGCGGAGAGGTCTCGTGCGCGGACATCGTCGCGCTGGCGGGCCGGGACGCCGCGGCGATTGCTGGCGGCCCGG
ATTTCCCCATCCAGCTCGGGCGGAGGGATGCCACATTCGCGAGCAATCGCGCCGCCGACGCGGCGCTGCCCCCGCCCACGATCAGCGTCGACAAATTCCTGGAAATCTTCCGCGCCATGG
GCATGTCCATCGAGGAGAGCGTGGCGATCATGGGCGCGCACACGCTGGGCGTCGGCCACTGTCTCAACATCGTCAATCGCCTCTACCCGACCCTGGATTCCAACCTCAATCCCTTCTACG
CGGCGCGCCTCCGGATCAGCTGTCCCGTCTCGGATCCGCGATTCATTCTCAACACCACCACGGTGATGAACGATTTCACCAGCTTGCGATTCGACAATCGCTACTACCAGGAGGTGAGCT
CCAGGCTCGGGCTCTTCAGCATCGACGCGGCGCTGGGCCAAGACTCGAGAACCAGCACCGCCGTAGCGAAATTCGCCCAGGACCAGAACCAATTCTTCCAGACATACATCACCGCCTACC
AGAAGCTCACCGCCCACAAGGTGCTCACGGGCAGTAGCGGCCAGATCAGGAAGAACTGCCGCTACGTGAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGTGAATTGGGGATCCAATTTCGCAATGTGGGTGATTCTAGCCATGGTCCTGACACTCGCAAGCTCGAGCTCCTCCCAGCTCTCGTTCGGTTTCTACAAGAAATCTTGCCCGGGG
CTGGAGAGCACGGTGAGATCGACGATCATGAGCAGCCTCTTTGGCGATCCCACCGCCGCGGCGGCGCTCCTCCGCCTCTCCTTCCACGACTGCCAAGTCGGG
GGCTGCGACGCATCGATC
CTGCTCAACAACAAGGGCTCCATCACCAGCGAGATGGTGTCCGATCGAAATTTCGGCGTCCGGGAGCTCGCGATCATCGATCGGATCAAGGCGGCGGTGGATGCGCAATGCGGCGGCGGA
GAGGTCTCGTGCGCGGACATCGTCGCGCTGGCGGGCCGGGACGCCGCGGCGATTGCTGGCGGCCCGGATTTCCCCATCCAGCTCGGGCGGAGGGATGCCACATTCGCGAGCAATCGCGCC
GCCGACGCGGCGCTGCCCCCGCCCACGATCAGCGTCGACAAATTCCTGGAAATCTTCCGCGCCATGGGCATGTCCATCGAGGAGAGCGTGGCGATCATGGGCGCGCACACGCTGGGCGTC
GGCCACTGTCTCAACATCGTCAATCGCCTCTACCCGACCCTGGATTCCAACCTCAATCCCTTCTACGCGGCGCGCCTCCGGATCAGCTGTCCCGTCTCGGATCCGCGATTCATTCTCAAC
ACCACCACGGTGATGAACGATTTCACCAGCTTGCGATTCGACAATCGCTACTACCAGGAGGTGAGCTCCAGGCTCGGGCTCTTCAGCATCGACGCGGCGCTGGGCCAAGACTCGAGAACC
AGCACCGCCGTAGCGAAATTCGCCCAGGACCAGAACCAATTCTTCCAGACATACATCACCGCCTACCAGAAGCTCACCGCCCACAAGGTGCTCACGGGCAGTAGCGGCCAGATCAGGAAG
AACTGCCGCTACGTGAATTGA

Retrieve as FASTA