Entry information : SmPrx12-2_55 (SmPrx12b_55)
Entry ID 7045
Creation 2009-10-15 (Paula Nunes)
Last sequence changes 2009-10-15 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx12-2_55 (SmPrx12b_55)
Name (synonym) SmPrx12-2_55 (SmPrx12b_55)
Class Class III peroxidase    [Orthogroup: Prx203]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx12-2_55
start..stop
S start..stop
SmPrx12-1_113 666 0 1..326 1..326
SmPrx11-1_35 408 7e-144 9..326 14..332
SmPrx11-2_41 406 4e-143 9..326 14..332
SmPrx52-1_16 356 3e-123 11..326 32..346
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 113594..113815 222 N° 2 112772..113530 759  
complement(join(112772..113530,113594..113815))


exon

Literature and cross-references SmPrx12-2_55 (SmPrx12b_55)
DNA ref. Phytozome 12:   scaffold_55 (113815..112772)
mRNA ref. JGI transcript:   116945 [Incorrect prediction]
Protein sequence: SmPrx12-2_55 (SmPrx12b_55)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (302)
PWM (Da):   %s   34970.53 (32377.2) Transmb domain:   %s   i5-27o
PI (pH):   %s   7.98 (7.98) Peptide Signal:   %s   cut: 25 range:25-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVNWGSNFAMWVILAMVLTLASSSSSQLSFGFYKKSCPGLESTVRSTIMSSLFGDPTAGAALLRLSFHDCQVGGCDASILLNNKGSITSEMASDRNFGVRELAIIDRIKAAVDAQCGGGEVSCADIVALAGRDAAAIAGGPDFPIQLGRRDATFASNRAADAALPPPTISVDKFLDIFRAMGMSIEESVAIMGAHTLGVGHCLNIVNRLYPTLDSNLNPFYAARLRISCPVSDPRFILNTTTVMNDFTSLRFDNRYYQEVSSRLGLFSIDAALGQDSRTSTAVAKFAQDQNQFFQTYITAYQKLTAHKVLTGSSGQIRKNCRYVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (intron 1). No ESTs. Incorrect prediction (short SP).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGTGAATTGGGGATCCAATTTCGCAATGTGGGTGATTCTAGCCATGGTCCTGACACTCGCAAGCTCGAGCTCCTCCCAGCTCTCGTTCGGTTTCTACAAGAAATCTTGCCCGGGG
CTGGAGAGCACGGTGAGATCGACGATCATGAGCAGCCTCTTTGGCGATCCCACCGCCGGGGCGGCGCTCCTCCGCCTCTCCTTCCACGACTGCCAAGTCGGG
GTAAGCTAGATAGACTTT
ATCGAGAGAGCTGGCCACTGACATCCTCGATCAATTTCCATCCAGGGCTGCGACGCATCGATCCTGCTCAACAACAAGGGCTCCATCACCAGCGAGATGGCGTCCGATCGAAATTTCGGC
GTCCGGGAGCTCGCGATCATCGATCGGATCAAGGCGGCGGTGGACGCGCAATGCGGCGGCGGAGAGGTCTCGTGCGCGGACATCGTCGCGCTAGCGGGCCGGGACGCCGCGGCGATTGCT
GGCGGCCCGGATTTCCCCATCCAGCTCGGGCGGAGGGATGCCACATTCGCGAGCAATCGCGCCGCCGACGCGGCGCTGCCCCCGCCCACGATCAGCGTCGACAAATTTCTGGATATCTTC
CGCGCCATGGGCATGTCCATCGAGGAGAGCGTGGCGATCATGGGCGCGCACACGCTGGGCGTCGGCCACTGCCTCAACATCGTCAATCGCCTCTACCCGACCCTGGATTCCAACCTCAAT
CCCTTCTACGCGGCGCGCCTCCGGATCAGCTGCCCCGTCTCGGATCCGCGATTCATTCTCAACACCACCACGGTGATGAACGATTTCACCAGCTTGCGATTCGACAATCGCTACTACCAG
GAGGTGAGCTCCAGGCTCGGGCTCTTCAGCATCGACGCGGCGCTGGGCCAAGACTCGAGAACCAGCACCGCGGTAGCGAAATTCGCCCAGGACCAGAACCAATTCTTCCAGACATACATC
ACCGCCTACCAGAAGCTCACCGCCCACAAGGTGCTCACGGGCAGTAGCGGCCAGATCAGGAAGAACTGCCGCTACGTGAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGTGAATTGGGGATCCAATTTCGCAATGTGGGTGATTCTAGCCATGGTCCTGACACTCGCAAGCTCGAGCTCCTCCCAGCTCTCGTTCGGTTTCTACAAGAAATCTTGCCCGGGG
CTGGAGAGCACGGTGAGATCGACGATCATGAGCAGCCTCTTTGGCGATCCCACCGCCGGGGCGGCGCTCCTCCGCCTCTCCTTCCACGACTGCCAAGTCGGG
GGCTGCGACGCATCGATC
CTGCTCAACAACAAGGGCTCCATCACCAGCGAGATGGCGTCCGATCGAAATTTCGGCGTCCGGGAGCTCGCGATCATCGATCGGATCAAGGCGGCGGTGGACGCGCAATGCGGCGGCGGA
GAGGTCTCGTGCGCGGACATCGTCGCGCTAGCGGGCCGGGACGCCGCGGCGATTGCTGGCGGCCCGGATTTCCCCATCCAGCTCGGGCGGAGGGATGCCACATTCGCGAGCAATCGCGCC
GCCGACGCGGCGCTGCCCCCGCCCACGATCAGCGTCGACAAATTTCTGGATATCTTCCGCGCCATGGGCATGTCCATCGAGGAGAGCGTGGCGATCATGGGCGCGCACACGCTGGGCGTC
GGCCACTGCCTCAACATCGTCAATCGCCTCTACCCGACCCTGGATTCCAACCTCAATCCCTTCTACGCGGCGCGCCTCCGGATCAGCTGCCCCGTCTCGGATCCGCGATTCATTCTCAAC
ACCACCACGGTGATGAACGATTTCACCAGCTTGCGATTCGACAATCGCTACTACCAGGAGGTGAGCTCCAGGCTCGGGCTCTTCAGCATCGACGCGGCGCTGGGCCAAGACTCGAGAACC
AGCACCGCGGTAGCGAAATTCGCCCAGGACCAGAACCAATTCTTCCAGACATACATCACCGCCTACCAGAAGCTCACCGCCCACAAGGTGCTCACGGGCAGTAGCGGCCAGATCAGGAAG
AACTGCCGCTACGTGAATTGA

Retrieve as FASTA