Entry information : SmPrx71-2_98 (SmPrx71b_98)
Entry ID 7049
Creation 2009-10-18 (Paula Nunes)
Last sequence changes 2009-10-18 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx71-2_98 (SmPrx71b_98)
Name (synonym) SmPrx71-2_98 (SmPrx71b_98)
Class Class III peroxidase    [Orthogroup: Prx205]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx71-2_98
start..stop
S start..stop
SmPrx71-1_4 637 0 1..319 1..319
SmPrx91-1_24 413 2e-146 10..319 12..322
SmPrx91-2_26 413 5e-146 10..319 12..322
SmPrx58-1_129 387 3e-136 7..319 3..315
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 485392..485595 204 N° 2 485139..485321 183 N° 3 484492..485064 573  
complement(join(484492..485064,485139..485321,485392..485595))


exon

Literature and cross-references SmPrx71-2_98 (SmPrx71b_98)
DNA ref. Phytozome 12:   scaffold_98 (485595..484492)
mRNA ref. JGI transcript:   129957
Protein sequence: SmPrx71-2_98 (SmPrx71b_98)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   319 (298)
PWM (Da):   %s   33961.78 (31824.7)  
PI (pH):   %s   5.91 (5.91) Peptide Signal:   %s   cut: 22 range:22-319
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MACKLLFVAFLALSLGDCALGALSSSFYATSCPNLTNIVHAAVQQVVASEPRMCASLIRLFFHDCHVNGCDASILLAGASLEQNAFPNINSVRGYDVVNNIKALIEAQCPRKVSCADELVLIAQQCVTALGGPSWSVLFGRRDSLNASQSAANTNLPPPTFNVSALIANFQAHGLSLQDMVALSGAHTVGKSHCSSFKRRLYGPFQAGDAMNPTFNTSLQSQCPNVSSSDNNLVDLDQLTPVVFDNKYFVDLLNGTGVLFSDETLAIGGNSTAESLVWTYASNQTRFFLDFVTGMINMGNESPLQAPNGQIRLNCSRVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGTAAACTTCTCTTCGTTGCATTCCTAGCTTTAAGCCTAGGTGATTGTGCACTGGGAGCTCTCAGCTCCTCGTTCTACGCCACCTCATGCCCGAATCTCACCAACATCGTGCAT
GCCGCAGTGCAGCAAGTCGTGGCGTCCGAGCCCAGAATGTGTGCTTCGCTAATCCGCCTCTTCTTCCACGATTGTCACGTGAAC
GTAAGCTCGAACATCGCATTTTTCTTCTTTTAAATG
ATATAACCTCTGGAATTCAATGGATCATATGCAGGGCTGCGATGCGTCGATTCTCTTGGCCGGAGCGAGCCTCGAGCAGAACGCGTTCCCAAACATAAACTCGGTGCGAGGATACGACGT
TGTCAACAACATCAAGGCTCTCATCGAGGCCCAGTGCCCCAGGAAGGTGTCTTGCGCGGACGAGCTCGTCTTGATCGCCCAACAATGCGTCACCGCA
GTACGTATATCAACAATGCGATA
TATTGATCATCCCATGATCATTTACTAATTGATCTTCCATGCTACGTGCAGCTCGGAGGCCCATCCTGGAGCGTCCTCTTCGGACGAAGGGACAGCCTAAACGCGAGCCAGTCGGCAGCG
AACACAAACCTCCCACCTCCCACCTTCAACGTCTCGGCGCTCATCGCAAACTTCCAGGCCCACGGCCTGTCGCTCCAGGACATGGTCGCCCTCTCTGGAGCCCACACCGTCGGGAAATCC
CACTGCTCCAGCTTCAAGCGCCGCCTCTACGGCCCCTTCCAGGCCGGGGACGCCATGAATCCCACCTTCAACACTTCGCTGCAGAGCCAGTGCCCCAACGTGAGCTCCAGCGACAACAAT
CTCGTGGATCTGGACCAGCTCACGCCGGTGGTGTTCGACAACAAGTATTTCGTGGATCTCTTGAATGGCACCGGGGTGCTCTTCTCAGACGAGACGCTCGCCATCGGTGGCAACTCCACT
GCCGAGTCGCTGGTGTGGACTTATGCGTCCAACCAGACGCGCTTCTTCCTGGATTTCGTGACTGGGATGATCAACATGGGGAACGAGAGTCCGCTCCAAGCTCCGAATGGACAGATCCGG
CTCAATTGCTCCCGGGTCAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGTAAACTTCTCTTCGTTGCATTCCTAGCTTTAAGCCTAGGTGATTGTGCACTGGGAGCTCTCAGCTCCTCGTTCTACGCCACCTCATGCCCGAATCTCACCAACATCGTGCAT
GCCGCAGTGCAGCAAGTCGTGGCGTCCGAGCCCAGAATGTGTGCTTCGCTAATCCGCCTCTTCTTCCACGATTGTCACGTGAAC
GGCTGCGATGCGTCGATTCTCTTGGCCGGAGCGAGC
CTCGAGCAGAACGCGTTCCCAAACATAAACTCGGTGCGAGGATACGACGTTGTCAACAACATCAAGGCTCTCATCGAGGCCCAGTGCCCCAGGAAGGTGTCTTGCGCGGACGAGCTCGTC
TTGATCGCCCAACAATGCGTCACCGCA
CTCGGAGGCCCATCCTGGAGCGTCCTCTTCGGACGAAGGGACAGCCTAAACGCGAGCCAGTCGGCAGCGAACACAAACCTCCCACCTCCCACC
TTCAACGTCTCGGCGCTCATCGCAAACTTCCAGGCCCACGGCCTGTCGCTCCAGGACATGGTCGCCCTCTCTGGAGCCCACACCGTCGGGAAATCCCACTGCTCCAGCTTCAAGCGCCGC
CTCTACGGCCCCTTCCAGGCCGGGGACGCCATGAATCCCACCTTCAACACTTCGCTGCAGAGCCAGTGCCCCAACGTGAGCTCCAGCGACAACAATCTCGTGGATCTGGACCAGCTCACG
CCGGTGGTGTTCGACAACAAGTATTTCGTGGATCTCTTGAATGGCACCGGGGTGCTCTTCTCAGACGAGACGCTCGCCATCGGTGGCAACTCCACTGCCGAGTCGCTGGTGTGGACTTAT
GCGTCCAACCAGACGCGCTTCTTCCTGGATTTCGTGACTGGGATGATCAACATGGGGAACGAGAGTCCGCTCCAAGCTCCGAATGGACAGATCCGGCTCAATTGCTCCCGGGTCAATTGA

Retrieve as FASTA