Entry information : SmPrx73-1_120 (SmPrx73a_120)
Entry ID 7051
Creation 2009-10-18 (Paula Nunes)
Last sequence changes 2009-10-18 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx73-1_120 (SmPrx73a_120)
Name (synonym) SmPrx73-1_120 (SmPrx73a_120)
Class Class III peroxidase    [Orthogroup: Prx163]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx73-1_120
start..stop
S start..stop
SmPrx73-2_39 653 0 1..325 1..325
SmPrx103-1_73 440 1e-156 25..324 26..325
SmPrx103-2_90 436 4e-155 25..324 25..324
SmPrx56-2_33 374 2e-130 3..324 9..335
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 203254..203463 210 N° 2 202982..203173 192 N° 3 202745..202910 166 N° 4 202277..202686 410
complement(join(202277..202686,202745..202910,202982..203173,203254..203463))


exon

Literature and cross-references SmPrx73-1_120 (SmPrx73a_120)
DNA ref. Phytozome 12:   scaffold_120 (203463..202277)
mRNA ref. JGI transcript:   272212
EST ref. GenBank:   FE458590.1 [5' end]   FE461323.1 [3' end]
Protein sequence: SmPrx73-1_120 (SmPrx73a_120)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (307)
PWM (Da):   %s   34282.42 (32391.4)  
PI (pH):   %s   7.98 (7.99) Peptide Signal:   %s   cut: 19 range:19-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MISTYSLLLLLIATSSLAFSAEAALATGYYDSTCPQVEKIVKAGVANAAQSDSRLPASLLRLHFHDCFVQGCDASVLLDDTPTFKGEKTAGPNNNSIRGFEAIDAIKSSLESSCKGVVSCADILALAARDSVVLSGGPSWEVPLGRRDSITASFSGATNRLPSFFSDVNGLIKSFTDVGLTAEDMFTLSGGHSIGQARCLAFVSRIFNDSGSGSPDPSIRPSFLSALQSKCPQTGSLSSLQPLDATTINKFDNQYYLNLVLGKGLLHSDQVLFNTVGVARNFVKAYSADQSKFFSNFAGSMIKMGKLSPLLAPKGIIRSNCRVPR

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and 3 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATCTCTACGTATTCTCTCCTGCTGCTTTTGATCGCTACTTCGTCTCTGGCCTTCTCGGCGGAGGCGGCGCTCGCGACTGGCTACTACGATTCGACATGCCCGCAAGTCGAGAAGATC
GTCAAGGCCGGGGTCGCAAACGCTGCGCAGTCCGACTCGCGATTGCCAGCGTCGCTTCTTCGTCTCCATTTCCACGACTGCTTCGTCCAA
GTAAGTCGCCTTCTCGTCCATTGGATCGGC
ACAACCGACCGCTAAGATTCGTCCCCCTGTTTGAATTTGAAATTTTCTAGGGGTGTGATGCGTCGGTGTTGCTGGACGATACTCCCACTTTCAAGGGGGAGAAGACCGCCGGCCCCAACA
ACAATTCCATCAGAGGATTCGAAGCAATCGACGCGATTAAATCGTCTCTCGAGAGCAGCTGCAAGGGGGTCGTGTCATGCGCGGACATCCTCGCGCTCGCAGCTCGGGATTCTGTCGTCC
TG
GTAGGAAATTCTAGTGATTTTCGGTGGAGTTCTTATGGATTCCCCTGTTTCTGCACGGAATTTGAGCGCAGAGTGGCGGGCCGTCGTGGGAAGTGCCACTGGGGCGACGAGATAGCAT
CACTGCGAGCTTCTCTGGAGCTACGAATCGACTGCCCAGTTTCTTCTCTGACGTGAATGGATTGATCAAATCCTTCACAGATGTTGGGCTCACAGCGGAAGATATGTTTACACTCTCTG
G
TAAGATGAAATTTTCCAAAGTTCGCATCCAATTCGCGAGAATTTGTCACGATTGCAGGGGGGCATTCGATCGGCCAGGCGCGATGCCTCGCTTTTGTGTCGAGGATCTTCAATGACAGCG
GCAGCGGCAGCCCCGATCCCAGCATTCGCCCTAGTTTTCTCTCCGCGCTCCAATCCAAATGCCCGCAAACTGGGAGTCTCAGCTCGCTCCAGCCCCTGGACGCAACCACGATCAACAAAT
TTGATAATCAGTACTACCTCAATCTCGTCCTGGGAAAGGGACTGCTCCACTCAGATCAAGTGCTTTTCAACACAGTCGGAGTGGCCAGGAATTTCGTCAAGGCATACAGCGCGGATCAAT
CGAAGTTCTTCAGCAACTTCGCGGGATCTATGATCAAGATGGGGAAATTGAGCCCTTTGCTCGCCCCGAAGGGGATCATTCGCAGCAATTGCCGAGTTCCAAGATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATCTCTACGTATTCTCTCCTGCTGCTTTTGATCGCTACTTCGTCTCTGGCCTTCTCGGCGGAGGCGGCGCTCGCGACTGGCTACTACGATTCGACATGCCCGCAAGTCGAGAAGATC
GTCAAGGCCGGGGTCGCAAACGCTGCGCAGTCCGACTCGCGATTGCCAGCGTCGCTTCTTCGTCTCCATTTCCACGACTGCTTCGTCCAA
GGGTGTGATGCGTCGGTGTTGCTGGACGAT
ACTCCCACTTTCAAGGGGGAGAAGACCGCCGGCCCCAACAACAATTCCATCAGAGGATTCGAAGCAATCGACGCGATTAAATCGTCTCTCGAGAGCAGCTGCAAGGGGGTCGTGTCATGC
GCGGACATCCTCGCGCTCGCAGCTCGGGATTCTGTCGTCCTG
AGTGGCGGGCCGTCGTGGGAAGTGCCACTGGGGCGACGAGATAGCATCACTGCGAGCTTCTCTGGAGCTACGAATCGA
CTGCCCAGTTTCTTCTCTGACGTGAATGGATTGATCAAATCCTTCACAGATGTTGGGCTCACAGCGGAAGATATGTTTACACTCTCTG
GGGGGCATTCGATCGGCCAGGCGCGATGCCTC
GCTTTTGTGTCGAGGATCTTCAATGACAGCGGCAGCGGCAGCCCCGATCCCAGCATTCGCCCTAGTTTTCTCTCCGCGCTCCAATCCAAATGCCCGCAAACTGGGAGTCTCAGCTCGCTC
CAGCCCCTGGACGCAACCACGATCAACAAATTTGATAATCAGTACTACCTCAATCTCGTCCTGGGAAAGGGACTGCTCCACTCAGATCAAGTGCTTTTCAACACAGTCGGAGTGGCCAGG
AATTTCGTCAAGGCATACAGCGCGGATCAATCGAAGTTCTTCAGCAACTTCGCGGGATCTATGATCAAGATGGGGAAATTGAGCCCTTTGCTCGCCCCGAAGGGGATCATTCGCAGCAAT
TGCCGAGTTCCAAGATGA

Retrieve as FASTA