Entry information : SmPrx74-1_88 (SmPrx74a_88)
Entry ID 7052
Creation 2009-10-19 (Christophe Dunand)
Last sequence changes 2009-10-19 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-01-26 (Toky Ramarohetra)
Peroxidase information: SmPrx74-1_88 (SmPrx74a_88)
Name (synonym) SmPrx74-1_88 (SmPrx74a_88)
Class Class III peroxidase    [Orthogroup: Prx078]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx74-1_88
start..stop
S start..stop
SmPrx74-2_39 656 0 1..329 1..329
SmPrx50-1_126 459 5e-164 13..329 8..327
SmPrx50-2_101 457 3e-163 13..329 8..327
SmPrx36-2_44 400 4e-140 11..329 55..375
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 648293..648704 412 N° 2 647516..648088 573  
complement(join(647516..648088,648293..648704))


exon

Literature and cross-references SmPrx74-1_88 (SmPrx74a_88)
DNA ref. JGI genome:   scaffold_88 (648704..647519)
mRNA ref. JGI transcript:   235541 [Sequencing error]
Protein sequence: SmPrx74-1_88 (SmPrx74a_88)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (301)
PWM (Da):   %s   35065.45 (31884.9) Transmb domain:   %s   i13-35o
PI (pH):   %s   8.66 (8.40) Peptide Signal:   %s   cut: 29 range:29-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKSWSSSPFQSLIIFLFLVSMCGMAFGQxSTTFYASTCPNLVQIVSGVVRRAVASEPRMAASLLRLHFHDCFVQGCDASLLLDDASGFTGEKSALPNQNSVRGFNVIDNIKTAVERQCPNVVSCADIVTLAAREGVTALQGPSWPVVLGRRDSTTASLSSANNDIPAPTSSASQLLSKFQAKGLSAQDLVATSGGHTIGQARCVTFRDRLYNFSNSGRPDPNLNALFLSRLQQQCTQSSASDNNLSPLDVRSANVFDNAYFVNLQFNRGLLNSDQVLSAGSTQALVNAYAGNNRRFFADFASAMVNMGNISPLTGSAGEIRKSCRARN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (intron 2). No EST. Probable sequencing error or frame shift in the PS => Prediction error from JGI (very long extra 5'intron).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CAAGAGTTGGTCTTCATCTCCATTCCAAAGCTTGATCATCTTCCTCTTTCTAGTATCGATGTGTGGAATGGCTTTTGGTCNNNNNAGCACCACATTCTATGCCTCGACTTGCCCAAACCT
GGTCCAGATCGTGAGCGGAGTCGTGAGGCGAGCAGTGGCGAGCGAGCCTCGCATGGCGGCCTCGCTCCTTCGGCTACACTTTCATGATTGTTTCGTCCAGGGCTGCGACGCATCGCTGCT
GCTCGACGACGCCTCGGGATTCACCGGGGAGAAATCCGCGCTTCCCAATCAAAACTCTGTGCGTGGATTCAATGTCATTGACAACATCAAGACCGCAGTGGAGAGGCAGTGTCCCAACGT
CGTCTCGTGCGCTGATATTGTCACGCTCGCAGCTAGAGAAGGCGTCACAGCG
GTAAGAGATCGAGTGGCCTCCTTGCTTCAATGTTTTCATGGGGTGTTCTAGTGTGGTAGTCTTCCTTA
CGCAAAGTTCTAGGAGTGTTCTAGCTTTCTCGCTTCTTTCTCTTGTTCCTTGAAGCTCTCGACTTGATATTCCTTGATCTTCCTGTTTCCTTGACTATAGATCTCAATGCTAATGTTTGT
GAGCCGTGCTATATAGTTGCAAGGCCCATCTTGGCCCGTGGTTTTGGGACGCAGAGACAGCACCACCGCAAGCCTCTCTTCCGCAAACAACGATATCCCAGCGCCAACATCCAGCGCCTC
GCAGCTCCTCTCCAAGTTCCAAGCCAAGGGACTCTCCGCCCAGGACCTGGTCGCAACATCCGGCGGCCACACAATCGGCCAGGCACGCTGCGTCACCTTTCGGGACCGCCTCTACAACTT
TAGCAACTCGGGCCGCCCGGATCCAAACCTCAACGCGCTCTTCCTCTCGCGCTTGCAGCAGCAGTGCACGCAATCCTCCGCCTCGGACAACAACCTCTCGCCCCTCGACGTGAGGAGTGC
CAACGTTTTCGACAACGCTTACTTTGTCAACCTGCAGTTCAACAGGGGGCTCCTCAACTCGGACCAGGTGCTGTCCGCTGGCAGCACGCAGGCCCTGGTGAACGCATACGCGGGCAACAA
CCGACGCTTCTTTGCGGACTTTGCGTCAGCTATGGTGAATATGGGCAACATTAGTCCTCTCACCGGCAGCGCGGGTGAGATCCGGAAGAGCTGCCGTGCCAGAAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
CAAGAGTTGGTCTTCATCTCCATTCCAAAGCTTGATCATCTTCCTCTTTCTAGTATCGATGTGTGGAATGGCTTTTGGTCNNNNNAGCACCACATTCTATGCCTCGACTTGCCCAAACCT
GGTCCAGATCGTGAGCGGAGTCGTGAGGCGAGCAGTGGCGAGCGAGCCTCGCATGGCGGCCTCGCTCCTTCGGCTACACTTTCATGATTGTTTCGTCCAGGGCTGCGACGCATCGCTGCT
GCTCGACGACGCCTCGGGATTCACCGGGGAGAAATCCGCGCTTCCCAATCAAAACTCTGTGCGTGGATTCAATGTCATTGACAACATCAAGACCGCAGTGGAGAGGCAGTGTCCCAACGT
CGTCTCGTGCGCTGATATTGTCACGCTCGCAGCTAGAGAAGGCGTCACAGCG
TTGCAAGGCCCATCTTGGCCCGTGGTTTTGGGACGCAGAGACAGCACCACCGCAAGCCTCTCTTCCGC
AAACAACGATATCCCAGCGCCAACATCCAGCGCCTCGCAGCTCCTCTCCAAGTTCCAAGCCAAGGGACTCTCCGCCCAGGACCTGGTCGCAACATCCGGCGGCCACACAATCGGCCAGGC
ACGCTGCGTCACCTTTCGGGACCGCCTCTACAACTTTAGCAACTCGGGCCGCCCGGATCCAAACCTCAACGCGCTCTTCCTCTCGCGCTTGCAGCAGCAGTGCACGCAATCCTCCGCCTC
GGACAACAACCTCTCGCCCCTCGACGTGAGGAGTGCCAACGTTTTCGACAACGCTTACTTTGTCAACCTGCAGTTCAACAGGGGGCTCCTCAACTCGGACCAGGTGCTGTCCGCTGGCAG
CACGCAGGCCCTGGTGAACGCATACGCGGGCAACAACCGACGCTTCTTTGCGGACTTTGCGTCAGCTATGGTGAATATGGGCAACATTAGTCCTCTCACCGGCAGCGCGGGTGAGATCCG
GAAGAGCTGCCGTGCCAGAAACTAA

Retrieve as FASTA