Entry information : SmPrx72-2_39 (SmPrx72b_39)
Entry ID 7053
Creation 2009-10-19 (Christophe Dunand)
Last sequence changes 2009-10-19 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx72-2_39 (SmPrx72b_39)
Name (synonym) SmPrx72-2_39 (SmPrx72b_39)
Class Class III peroxidase    [Orthogroup: Prx164]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx72-2_39
start..stop
S start..stop
SmPrx72-1_120 686 0 1..349 1..349
PtaPrx07 315 1e-106 10..343 1..341
PtaPrx23 313 9e-106 3..336 7..352
PsyPrx01 311 4e-105 3..336 4..349
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 657859..658104 246 N° 2 658174..658359 186 N° 3 658446..658614 169 N° 4 658683..659131 449
join(657859..658104,658174..658359,658446..658614,658683..659131)


exon

Literature and cross-references SmPrx72-2_39 (SmPrx72b_39)
DNA ref. Phytozome 12:   scaffold_39 (657859..659131)
mRNA ref. JGI transcript:   177321
EST ref. GenBank:   FE465647.1 [3' end]
Protein sequence: SmPrx72-2_39 (SmPrx72b_39)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   349 (322)
PWM (Da):   %s   37006.09 (34183.6) Transmb domain:   %s   i13-32o
PI (pH):   %s   4.76 (4.49) Peptide Signal:   %s   cut: 28 range:28-349
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARRSFCCSITTVVVLVAAFLPLLCGAQTFPAPAPGLAYGFYNTSCPSAESTVQQMMQSILTSNISEAAGIIRLFFHDCFVQGCDGSLLINATNGELFSIPNLTIRRSAIAIVEQIKARLESACPNTVSCSDILVLAARESVTQAGGPSFPVPTGRRDGTTFATNQTVLSFIPAPSFNFSQLNSSFQTKGLNEADLTALSGAHTIGIAHCSAFIGNLYPNVSSRFNSSFAQTLLQSCPSNTSNNVVNMDLVTPNAFDSQYFSNVLSGSVDFDSDAALLNSTTTQSSVQAFAANQTQFFNQFAVSFIKMSMIEVLTNSSGNIRNVCSVFNSNSSSTISLNSSPENFVEQV

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and 2 ESTs (FE503654.1).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGTAGAAGTTTTTGCTGCTCGATCACCACGGTGGTGGTGCTGGTCGCGGCATTCTTGCCGCTGCTGTGTGGAGCTCAAACTTTCCCAGCTCCGGCACCTGGACTGGCCTATGGA
TTCTACAACACCTCCTGTCCCAGCGCCGAGAGCACCGTCCAGCAAATGATGCAGTCCATTCTCACCTCCAACATCTCCGAGGCCGCTGGGATCATCCGGCTCTTCTTCCACGACTGCTTC
GTCCAG
GTTGCTCGACCTTTCTCTCTCTCTCTTTGTTTCTTCCGAGTTGTTCTAGGAACTTTGCTGTGATCGCAGGGATGCGATGGCTCGCTTCTCATCAATGCTACCAACGGGGAGCTC
TTCTCGATCCCGAACTTGACCATTCGTCGCTCTGCTATTGCCATCGTGGAGCAGATCAAGGCGAGATTGGAGTCGGCCTGTCCGAACACTGTCTCTTGCTCGGATATACTCGTCTTGGCT
GCTCGAGAATCCGTGACCCAG
GTACTACCAAAGTCCTGTAAGCTTTTGTCGTGCCAAACCTCACAACAAATCATGTGATCCTTTGCTGTGTTCTTGCCTTCTAAAAGGCTGGAGGACCAT
CGTTTCCTGTTCCAACCGGACGTCGCGACGGCACGACCTTCGCCACTAACCAGACTGTTCTCAGCTTCATCCCGGCTCCCAGCTTCAACTTCTCACAGCTTAACTCCTCCTTCCAGACCA
AAGGCTTGAACGAAGCGGACTTAACAGCTCTCTCAG
GTAAAGCAAGCTCCAAAACTTCTCTTGGACCGTTCCAAAAACTCTGTCCTCGCTGCCGCTGCTTTCAGGAGCTCACACCATCGG
AATCGCGCACTGCTCGGCCTTCATTGGGAACCTGTATCCCAACGTCAGCTCCCGTTTCAACTCTTCCTTTGCACAGACCCTGTTGCAGTCCTGCCCAAGCAACACTTCCAACAACGTCGT
CAACATGGACCTGGTCACCCCGAATGCCTTCGACAGCCAGTACTTCAGCAACGTTCTCTCTGGCTCCGTCGACTTCGACTCGGACGCTGCTCTTCTTAACAGCACCACCACGCAGAGCAG
CGTGCAGGCTTTCGCAGCGAACCAGACCCAGTTCTTCAACCAGTTTGCCGTGAGCTTCATCAAGATGAGCATGATCGAAGTCCTGACCAACTCGAGCGGGAACATTCGCAATGTCTGCTC
GGTCTTCAACTCCAACAGCAGTAGCACTATTAGCCTGAACTCGTCCCCTGAGAACTTTGTCGAGCAAGTGTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGTAGAAGTTTTTGCTGCTCGATCACCACGGTGGTGGTGCTGGTCGCGGCATTCTTGCCGCTGCTGTGTGGAGCTCAAACTTTCCCAGCTCCGGCACCTGGACTGGCCTATGGA
TTCTACAACACCTCCTGTCCCAGCGCCGAGAGCACCGTCCAGCAAATGATGCAGTCCATTCTCACCTCCAACATCTCCGAGGCCGCTGGGATCATCCGGCTCTTCTTCCACGACTGCTTC
GTCCAG
GGATGCGATGGCTCGCTTCTCATCAATGCTACCAACGGGGAGCTCTTCTCGATCCCGAACTTGACCATTCGTCGCTCTGCTATTGCCATCGTGGAGCAGATCAAGGCGAGATTG
GAGTCGGCCTGTCCGAACACTGTCTCTTGCTCGGATATACTCGTCTTGGCTGCTCGAGAATCCGTGACCCAG
GCTGGAGGACCATCGTTTCCTGTTCCAACCGGACGTCGCGACGGCACG
ACCTTCGCCACTAACCAGACTGTTCTCAGCTTCATCCCGGCTCCCAGCTTCAACTTCTCACAGCTTAACTCCTCCTTCCAGACCAAAGGCTTGAACGAAGCGGACTTAACAGCTCTCTCA
G
GAGCTCACACCATCGGAATCGCGCACTGCTCGGCCTTCATTGGGAACCTGTATCCCAACGTCAGCTCCCGTTTCAACTCTTCCTTTGCACAGACCCTGTTGCAGTCCTGCCCAAGCAAC
ACTTCCAACAACGTCGTCAACATGGACCTGGTCACCCCGAATGCCTTCGACAGCCAGTACTTCAGCAACGTTCTCTCTGGCTCCGTCGACTTCGACTCGGACGCTGCTCTTCTTAACAGC
ACCACCACGCAGAGCAGCGTGCAGGCTTTCGCAGCGAACCAGACCCAGTTCTTCAACCAGTTTGCCGTGAGCTTCATCAAGATGAGCATGATCGAAGTCCTGACCAACTCGAGCGGGAAC
ATTCGCAATGTCTGCTCGGTCTTCAACTCCAACAGCAGTAGCACTATTAGCCTGAACTCGTCCCCTGAGAACTTTGTCGAGCAAGTGTGA

Retrieve as FASTA