Entry information : SmPrx73-2_39 (SmPrx73b_39)
Entry ID 7054
Creation 2009-10-19 (Christophe Dunand)
Last sequence changes 2009-10-19 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx73-2_39 (SmPrx73b_39)
Name (synonym) SmPrx73-2_39 (SmPrx73b_39)
Class Class III peroxidase    [Orthogroup: Prx163]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx73-2_39
start..stop
S start..stop
SmPrx73-1_120 653 0 1..325 1..325
SmPrx103-1_73 440 1e-156 25..324 26..325
SmPrx103-2_90 436 4e-155 25..324 25..324
SmPrx56-2_33 374 2e-130 3..324 9..335
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 722576..722785 210 N° 2 722303..722494 192 N° 3 722066..722231 166 N° 4 721598..722007 410
complement(join(721598..722007,722066..722231,722303..722494,722576..722785))


exon

Literature and cross-references SmPrx73-2_39 (SmPrx73b_39)
DNA ref. Phytozome 12:   scaffold_39 (722785..721598)
mRNA ref. JGI transcript:   271350
EST ref. GenBank:   FE510693.1 [3' end]   FE446943.1 [Fragment]
Protein sequence: SmPrx73-2_39 (SmPrx73b_39)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (307)
PWM (Da):   %s   34311.41 (32420.3)  
PI (pH):   %s   7.7 (7.70) Peptide Signal:   %s   cut: 19 range:19-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MISTYSLLLLLIATSSLAFSAEAALATGYYDSTCPQVEKIVRAGVANAAQSDSRLPASLLRLHFHDCFVQGCDASVLLDDTPTFQGEKTAGPNNNSIRGFEAIDAIKSSLESSCKGVVSCADILALAARDSVVLSGGPSWEVPLGRRDSITASFSGATNRLPSFFSDVNGLIKSFTDVGLTAEDMFTLSGGHSIGQARCLAFVTRIFNDSGSGSPDPSIRPSFLSALQSKCPQTGSLSSLQPLDATTITKFDNQYYLNLVLGKGLLHSDQVLFNTVGVARNFVKAYSADQSKFFSNFAGSMIKMGKLSPLLAPKGIIRSNCRVPR

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and 5 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATCTCTACGTATTCTCTCCTGCTGCTTTTGATCGCTACTTCGTCTCTGGCCTTCTCGGCCGAGGCGGCGCTCGCGACTGGCTACTACGATTCGACATGCCCGCAAGTCGAAAAGATC
GTCAGGGCCGGGGTCGCAAACGCTGCGCAGTCCGACTCGCGGTTGCCAGCGTCGCTTCTTCGTCTCCATTTCCACGACTGCTTCGTCCAA
GTAAGTCGCCTTCTCGTCCATTGGATCCGG
CACAATCGACCGCTAAGATTCGTCCCCCTGTTTGAATTTGAAATTTTCTAGGGGTGTGATGCGTCGGTGTTGCTGGACGATACTCCCACTTTCCAGGGGGAGAAGACCGCCGGACCCAAC
AACAATTCCATCAGAGGATTCGAAGCAATCGACGCGATTAAATCGTCTCTCGAGAGCAGCTGCAAGGGGGTCGTGTCATGCGCGGACATCCTCGCGCTCGCAGCCCGGGATTCTGTCGTC
CTG
GTAGGAAATTCTAGTGATTTTCGGTGGAGTTCTTATGGATTCCCCTGTTTCTGCACGGAATTTGAGCGCAGAGTGGCGGGCCGTCGTGGGAAGTGCCACTGGGGCGACGAGATAGCA
TCACTGCGAGCTTCTCTGGAGCTACGAATCGACTGCCCAGTTTCTTCTCTGACGTGAATGGATTGATCAAATCCTTCACAGATGTTGGGCTCACAGCGGAAGATATGTTTACACTCTCTG
GTAAGATGAAATTTCCCAAAGTTCCCATCCAATTCGCGAGAATTTGTCACGATTGCAGGGGGGCATTCGATCGGCCAGGCTCGATGCCTCGCTTTTGTGACGAGGATCTTCAATGACAGC
GGCAGCGGCAGCCCCGATCCCAGCATTCGCCCTAGTTTTCTCTCCGCGCTCCAATCCAAATGCCCGCAAACTGGGAGTCTCAGCTCGCTCCAGCCCCTGGACGCAACCACGATCACCAAA
TTTGATAATCAGTACTACCTTAATCTCGTCCTGGGAAAGGGACTGCTCCACTCAGATCAAGTGCTATTCAACACAGTCGGAGTTGCCAGGAATTTCGTCAAGGCATACAGCGCGGATCAA
TCGAAGTTCTTCAGCAACTTCGCGGGATCTATGATCAAGATGGGGAAATTGAGCCCTTTGCTCGCCCCGAAGGGGATCATTCGCAGCAATTGCCGAGTTCCAAGATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATCTCTACGTATTCTCTCCTGCTGCTTTTGATCGCTACTTCGTCTCTGGCCTTCTCGGCCGAGGCGGCGCTCGCGACTGGCTACTACGATTCGACATGCCCGCAAGTCGAAAAGATC
GTCAGGGCCGGGGTCGCAAACGCTGCGCAGTCCGACTCGCGGTTGCCAGCGTCGCTTCTTCGTCTCCATTTCCACGACTGCTTCGTCCAA
GGGTGTGATGCGTCGGTGTTGCTGGACGAT
ACTCCCACTTTCCAGGGGGAGAAGACCGCCGGACCCAACAACAATTCCATCAGAGGATTCGAAGCAATCGACGCGATTAAATCGTCTCTCGAGAGCAGCTGCAAGGGGGTCGTGTCATGC
GCGGACATCCTCGCGCTCGCAGCCCGGGATTCTGTCGTCCTG
AGTGGCGGGCCGTCGTGGGAAGTGCCACTGGGGCGACGAGATAGCATCACTGCGAGCTTCTCTGGAGCTACGAATCGA
CTGCCCAGTTTCTTCTCTGACGTGAATGGATTGATCAAATCCTTCACAGATGTTGGGCTCACAGCGGAAGATATGTTTACACTCTCTG
GGGGGCATTCGATCGGCCAGGCTCGATGCCTC
GCTTTTGTGACGAGGATCTTCAATGACAGCGGCAGCGGCAGCCCCGATCCCAGCATTCGCCCTAGTTTTCTCTCCGCGCTCCAATCCAAATGCCCGCAAACTGGGAGTCTCAGCTCGCTC
CAGCCCCTGGACGCAACCACGATCACCAAATTTGATAATCAGTACTACCTTAATCTCGTCCTGGGAAAGGGACTGCTCCACTCAGATCAAGTGCTATTCAACACAGTCGGAGTTGCCAGG
AATTTCGTCAAGGCATACAGCGCGGATCAATCGAAGTTCTTCAGCAACTTCGCGGGATCTATGATCAAGATGGGGAAATTGAGCCCTTTGCTCGCCCCGAAGGGGATCATTCGCAGCAAT
TGCCGAGTTCCAAGATGA

Retrieve as FASTA