Entry information : SmPrx74-2_39 (SmPrx74b_39)
Entry ID 7055
Creation 2009-10-19 (Christophe Dunand)
Last sequence changes 2009-10-19 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx74-2_39 (SmPrx74b_39)
Name (synonym) SmPrx74-2_39 (SmPrx74b_39)
Class Class III peroxidase    [Orthogroup: Prx078]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx74-2_39
start..stop
S start..stop
SmPrx74-1_88 656 0 1..329 1..329
SmPrx50-1_126 460 1e-164 13..329 8..327
SmPrx50-2_101 458 6e-164 13..329 8..327
SmPrx36-2_44 398 2e-139 11..329 55..375
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 189906..190322 417 N° 2 190529..191101 573  
join(189906..190322,190529..191101)


exon

Literature and cross-references SmPrx74-2_39 (SmPrx74b_39)
DNA ref. Phytozome 12:   scaffold_39 (189906..191101)
mRNA ref. JGI transcript:   418626
Protein sequence: SmPrx74-2_39 (SmPrx74b_39)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (301)
PWM (Da):   %s   34927.4 (31944.0) Transmb domain:   %s   i13-35o
PI (pH):   %s   8.42 (8.40) Peptide Signal:   %s   cut: 29 range:29-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKSCSSSPFQSLIIFLFLVSMCGMAFGQLSTTFYASTCPNLVQIVSGVVRRAVASEPRMAASLLRLHFHDCFVQGCDASLLLDDASGFTGEKSALPNQNSVRGFNVIDNIKTAVERQCPNVVSCADIVTLAAREGVTALQGPSWPVVLGRRDSTTASLSSANNDIPAPTSSASQLLSKFQAKGLSAQDLVATSGGHTIGQARCVTFRDRLYNFSSSGRPDPNLNALFLSRLQQQCTQSSASDNSLSPLDVRSANVFDNAYFVNLQFNRGLLNSDQVLSAGSTQALVNAYAGNNRRFFADFASAMVNMGNISPLTGSAGEIRKSCRARN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (intron 2). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAAGAGTTGCTCTTCATCTCCATTCCAAAGCTTGATCATCTTCCTCTTTCTAGTATCGATGTGTGGAATGGCTTTTGGTCAGCTAAGCACCACATTCTATGCCTCGACTTGCCCA
AACCTGGTCCAGATCGTGAGCGGAGTCGTGAGGCGAGCAGTGGCGAGCGAGCCTCGTATGGCGGCCTCGCTCCTTCGGCTACACTTTCATGATTGTTTCGTCCAGGGCTGCGACGCATCT
CTGCTGCTCGACGACGCCTCGGGATTCACCGGGGAGAAATCCGCGCTTCCCAATCAAAACTCTGTGCGCGGATTCAATGTCATTGACAACATCAAGACCGCAGTGGAGAGGCAGTGTCCC
AACGTCGTCTCGTGCGCTGATATTGTCACGCTCGCAGCTAGAGAAGGCGTCACAGCG
GTAAGAGATCGAGTGGCCTCCTTGCTTCAATGTTTTCATGGGGTGTTCTAGTGTGGTATTCTT
CCTTACGCTTAAGCTCTAGCTAGTGTTCTAGCTTTCTCGCTTCTTTCTCTTGTTCCTTGAAGCTCTCGACTTGATATTCCTTGATCTTCCTGTTTCCTTGACTATAGATCTCAATGCTAA
TGGTTGTGATCCGTGCTATGTAGTTGCAAGGCCCATCTTGGCCCGTGGTTTTGGGACGCAGAGACAGCACCACCGCAAGCCTCTCTTCCGCAAACAACGATATCCCAGCGCCAACATCCA
GCGCCTCGCAGCTCCTCTCCAAGTTCCAAGCCAAGGGACTGTCCGCCCAGGACCTGGTAGCAACATCCGGCGGCCACACAATCGGCCAGGCACGCTGCGTCACCTTTCGGGACCGCCTCT
ACAACTTTAGCAGCTCGGGCCGCCCGGATCCAAACCTCAACGCGCTCTTCCTCTCGCGCCTGCAGCAGCAGTGCACGCAATCCTCCGCCTCGGACAACAGCCTCTCGCCCCTCGACGTGA
GGAGTGCCAACGTTTTCGACAACGCTTACTTTGTCAACCTGCAGTTCAACAGGGGGCTCCTCAACTCGGACCAGGTGCTGTCCGCTGGCAGCACGCAGGCCCTGGTGAACGCATACGCGG
GCAACAACCGACGCTTCTTTGCGGACTTTGCGTCAGCTATGGTGAATATGGGCAACATTAGTCCTCTCACCGGCAGCGCGGGCGAGATCCGGAAGAGCTGCCGTGCCAGAAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAAGAGTTGCTCTTCATCTCCATTCCAAAGCTTGATCATCTTCCTCTTTCTAGTATCGATGTGTGGAATGGCTTTTGGTCAGCTAAGCACCACATTCTATGCCTCGACTTGCCCA
AACCTGGTCCAGATCGTGAGCGGAGTCGTGAGGCGAGCAGTGGCGAGCGAGCCTCGTATGGCGGCCTCGCTCCTTCGGCTACACTTTCATGATTGTTTCGTCCAGGGCTGCGACGCATCT
CTGCTGCTCGACGACGCCTCGGGATTCACCGGGGAGAAATCCGCGCTTCCCAATCAAAACTCTGTGCGCGGATTCAATGTCATTGACAACATCAAGACCGCAGTGGAGAGGCAGTGTCCC
AACGTCGTCTCGTGCGCTGATATTGTCACGCTCGCAGCTAGAGAAGGCGTCACAGCG
TTGCAAGGCCCATCTTGGCCCGTGGTTTTGGGACGCAGAGACAGCACCACCGCAAGCCTCTCT
TCCGCAAACAACGATATCCCAGCGCCAACATCCAGCGCCTCGCAGCTCCTCTCCAAGTTCCAAGCCAAGGGACTGTCCGCCCAGGACCTGGTAGCAACATCCGGCGGCCACACAATCGGC
CAGGCACGCTGCGTCACCTTTCGGGACCGCCTCTACAACTTTAGCAGCTCGGGCCGCCCGGATCCAAACCTCAACGCGCTCTTCCTCTCGCGCCTGCAGCAGCAGTGCACGCAATCCTCC
GCCTCGGACAACAGCCTCTCGCCCCTCGACGTGAGGAGTGCCAACGTTTTCGACAACGCTTACTTTGTCAACCTGCAGTTCAACAGGGGGCTCCTCAACTCGGACCAGGTGCTGTCCGCT
GGCAGCACGCAGGCCCTGGTGAACGCATACGCGGGCAACAACCGACGCTTCTTTGCGGACTTTGCGTCAGCTATGGTGAATATGGGCAACATTAGTCCTCTCACCGGCAGCGCGGGCGAG
ATCCGGAAGAGCTGCCGTGCCAGAAACTAA

Retrieve as FASTA