Entry information : SmPrx76-1_52 (SmPrx76a_52)
Entry ID 7063
Creation 2009-10-19 (Paula Nunes)
Last sequence changes 2009-10-19 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx76-1_52 (SmPrx76a_52)
Name (synonym) SmPrx76-1_52 (SmPrx76a_52)
Class Class III peroxidase    [Orthogroup: Prx288]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx76-1_52
start..stop
S start..stop
SmPrx76-2_130 642 0 1..331 1..331
SmPrx52-2_1 328 2e-112 31..330 46..346
SmPrx52-1_16 328 3e-112 31..330 46..346
GbPrx82 305 2e-103 35..330 9..306
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1034428..1034676 249 N° 2 1034178..1034366 189 N° 3 1033955..1034120 166 N° 4 1033451..1033842 392
complement(join(1033451..1033842,1033955..1034120,1034178..1034366,1034428..1034 676))


exon

Literature and cross-references SmPrx76-1_52 (SmPrx76a_52)
DNA ref. Phytozome 12:   scaffold_52 (1034676..1033451)
mRNA ref. JGI transcript:   115982
Protein sequence: SmPrx76-1_52 (SmPrx76a_52)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (313)
PWM (Da):   %s   35838.24 (33981.2)  
PI (pH):   %s   6.73 (6.74) Peptide Signal:   %s   cut: 19 range:19-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASFALLLLLLLAISCLAVDQESSQRPQALGNSTSTSLRLGYYGSSCPNAETIVRQTLMTLLMQDPTAGAALLRLAFHDCDVMGCDASIILDSTPQFQSELESPKNFGIRRVDFIDRIKASLEGSCPRTVSCADIIALAARDSILLAGGPNIPVLTGRKDSTRADLVTANRKLATATSSVEEILQDFASMGINPQEAVSLLGAHTLGVGHCLSVVNRLYPSVDTKMDLMYSMALRVLCPSPKFYLNITAIPNDSTMFRFDNMFFKDAALRRVLFALDAAVESDPRTSIYTSKFAQNQGLFFDTFSRAFVKLTSVVNSEATQVRSNCRAINS

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCTTTCGCGTTGCTTCTCCTCCTCCTCCTCGCGATCTCTTGCCTCGCAGTGGATCAGGAGTCGTCACAGCGGCCGCAAGCTCTGGGAAATTCCACTTCCACCTCACTGCGATTG
GGATACTACGGATCCAGCTGCCCCAATGCCGAGACCATCGTGCGCCAGACGCTCATGACGCTCCTCATGCAAGATCCCACCGCTGGAGCGGCATTGCTTCGCCTCGCCTTCCACGATTGC
GATGTCATG
GTATGGATTCTTTCCTTCCAGGTGTTCTTGGATCATCTAGACTATTCTTCTGTGCCTTCAGGGCTGCGATGCATCGATCATCTTGGATTCCACTCCACAGTTTCAGAGCGA
GCTGGAATCTCCCAAGAACTTTGGCATCCGTCGCGTGGATTTCATCGATAGGATCAAGGCGTCGTTGGAGGGGAGCTGCCCGCGCACTGTCTCTTGCGCTGACATCATCGCTCTAGCTGC
TCGAGACTCCATCTTGCTG
GTAAGAAGATCTTTCCTTTCTTCTCTTTTCTTTGTTTGCCTTAGCGAGAATTTGCAGGCTGGAGGACCAAACATTCCTGTTCTAACGGGTCGCAAAGATAG
CACGAGAGCGGACCTCGTGACCGCGAATCGCAAGCTTGCCACTGCCACTTCTTCCGTGGAGGAAATTCTCCAAGACTTCGCGTCCATGGGAATTAACCCGCAAGAGGCTGTGTCTCTTCT
CG
GTGAGTGTGTTCTTCCATAGTTTCCTTGGTTTTAGCCTCTAGTTTCTTTCGATCGATCGAGCGGCTCGTCCTTCTCTTTGGCTGATATACTTGGTGATATACTTGGTTCCAGGAGCTC
ACACTCTTGGAGTTGGGCACTGCTTGAGCGTTGTCAACCGGCTCTATCCAAGCGTTGATACCAAGATGGATCTCATGTACTCGATGGCGTTGCGAGTGTTGTGCCCGAGTCCGAAGTTCT
ACCTCAACATCACGGCCATCCCAAACGATTCAACCATGTTTAGATTCGACAACATGTTCTTCAAGGACGCTGCCTTGCGGCGGGTGCTCTTCGCGCTTGATGCTGCTGTCGAGAGCGATC
CCAGGACCTCGATCTATACTTCCAAGTTTGCTCAGAACCAGGGATTGTTCTTCGACACATTCTCGCGAGCGTTTGTCAAGCTCACCAGCGTCGTTAACTCGGAAGCCACGCAGGTTCGAT
CGAATTGCCGCGCGATCAACTCGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCTTTCGCGTTGCTTCTCCTCCTCCTCCTCGCGATCTCTTGCCTCGCAGTGGATCAGGAGTCGTCACAGCGGCCGCAAGCTCTGGGAAATTCCACTTCCACCTCACTGCGATTG
GGATACTACGGATCCAGCTGCCCCAATGCCGAGACCATCGTGCGCCAGACGCTCATGACGCTCCTCATGCAAGATCCCACCGCTGGAGCGGCATTGCTTCGCCTCGCCTTCCACGATTGC
GATGTCATG
GGCTGCGATGCATCGATCATCTTGGATTCCACTCCACAGTTTCAGAGCGAGCTGGAATCTCCCAAGAACTTTGGCATCCGTCGCGTGGATTTCATCGATAGGATCAAGGCG
TCGTTGGAGGGGAGCTGCCCGCGCACTGTCTCTTGCGCTGACATCATCGCTCTAGCTGCTCGAGACTCCATCTTGCTG
GCTGGAGGACCAAACATTCCTGTTCTAACGGGTCGCAAAGAT
AGCACGAGAGCGGACCTCGTGACCGCGAATCGCAAGCTTGCCACTGCCACTTCTTCCGTGGAGGAAATTCTCCAAGACTTCGCGTCCATGGGAATTAACCCGCAAGAGGCTGTGTCTCTT
CTCG
GAGCTCACACTCTTGGAGTTGGGCACTGCTTGAGCGTTGTCAACCGGCTCTATCCAAGCGTTGATACCAAGATGGATCTCATGTACTCGATGGCGTTGCGAGTGTTGTGCCCGAGT
CCGAAGTTCTACCTCAACATCACGGCCATCCCAAACGATTCAACCATGTTTAGATTCGACAACATGTTCTTCAAGGACGCTGCCTTGCGGCGGGTGCTCTTCGCGCTTGATGCTGCTGTC
GAGAGCGATCCCAGGACCTCGATCTATACTTCCAAGTTTGCTCAGAACCAGGGATTGTTCTTCGACACATTCTCGCGAGCGTTTGTCAAGCTCACCAGCGTCGTTAACTCGGAAGCCACG
CAGGTTCGATCGAATTGCCGCGCGATCAACTCGTAG

Retrieve as FASTA