Entry information : SmPrx76-2_130 (SmPrx76b_130)
Entry ID 7064
Creation 2009-10-19 (Paula Nunes)
Last sequence changes 2009-10-19 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx76-2_130 (SmPrx76b_130)
Name (synonym) SmPrx76-2_130 (SmPrx76b_130)
Class Class III peroxidase    [Orthogroup: Prx288]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx76-2_130
start..stop
S start..stop
SmPrx76-1_52 642 0 1..331 1..331
SmPrx52-2_1 332 7e-114 31..330 46..346
SmPrx52-1_16 332 9e-114 31..330 46..346
GbPrx82 307 2e-104 35..330 9..306
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 331340..331588 249 N° 2 331089..331277 189 N° 3 330866..331031 166 N° 4 330362..330753 392
complement(join(330362..330753,330866..331031,331089..331277,331340..331588))


exon

Literature and cross-references SmPrx76-2_130 (SmPrx76b_130)
DNA ref. Phytozome 12:   scaffold_130 (331588..330362)
mRNA ref. JGI transcript:   134943
Protein sequence: SmPrx76-2_130 (SmPrx76b_130)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   331 (313)
PWM (Da):   %s   35743.15 (33843.1)  
PI (pH):   %s   7.64 (7.24) Peptide Signal:   %s   cut: 19 range:19-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASFALLLLLLLAISCRAVDQESSPRAQALGNSTSTSLRLGYYGSSCPNAETIVRQTLMTLLMQDPTAGAALLRLAFHDCDVMGCDASIILDSTAQFQSELESPKNFGIRRVDFIDRIKASLEGSCPRTVSCADIIALAARDSILLAGGPNIPVLTGRKDSTRADLATANRKLATATSSVEEILQDFASMGINPQEAVSLLGAHTLGVGHCLSVVNRLYPSVDTKMDLMYSMALRVLCPSPKFYLNITAIPNDSTMFRFDNMFFKDAASRRVLFALDAAVQSDPRTSIYTSKFAQNQGLFFDTFSRAFVKLTSVVNSEATQVRSNCRAINS

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCTTTCGCGTTGCTTCTCCTCCTCCTCCTCGCAATCTCTTGCCGCGCAGTGGATCAGGAGTCGTCACCGCGGGCGCAAGCTCTGGGAAATTCCACTTCCACCTCACTGCGATTG
GGATACTACGGATCCAGCTGCCCCAATGCCGAGACCATCGTGCGCCAGACGCTCATGACGCTCCTCATGCAAGATCCCACCGCTGGAGCGGCATTGCTTCGCCTCGCCTTCCACGATTGC
GATGTCATG
GTATGGATTCTTTCCTTACAGGTGTTCTTGGATCATCTAGACGATTCTTCTGTGCTTTCCAGGGCTGCGATGCATCGATCATCTTGGATTCCACTGCACAGTTTCAGAGCG
AGCTGGAATCTCCCAAGAACTTTGGCATTCGTCGCGTGGATTTCATCGATAGGATCAAGGCGTCGTTGGAGGGGAGCTGCCCGCGCACTGTCTCTTGCGCTGACATCATCGCTCTAGCTG
CTCGAGACTCCATCTTGCTG
GTAAGAAGATCTTTCCTTTCCTCTCTTTTCTTTGTTTGCCTTAGCGAGAATTTGCAGGCTGGAGGACCAAACATTCCTGTTCTAACGGGTCGCAAAGATA
GCACGAGAGCGGACCTCGCTACCGCTAATCGCAAGCTTGCCACTGCCACTTCTTCCGTGGAGGAAATTCTCCAAGACTTCGCGTCCATGGGAATTAACCCGCAAGAGGCTGTGTCTCTTC
TCG
GTGAGTGTGTTCTCCCATAGTTTCCTTGGTCTTAGTCTCTAGTTTCTTTCGATCGATCGAGCGGCTCTTCCTTCTCTTTGGCTGATATACTTGGTGATATACTTGGTTCCAGGAGCT
CACACTCTTGGAGTTGGGCACTGCTTGAGCGTTGTCAACCGGCTCTATCCAAGCGTTGATACCAAGATGGATCTCATGTACTCGATGGCGTTGCGAGTGTTGTGCCCGAGTCCAAAGTTC
TACCTCAACATCACGGCCATCCCAAACGATTCAACCATGTTTAGATTCGACAACATGTTCTTCAAGGACGCTGCCTCGCGGCGGGTGCTCTTCGCGCTTGATGCCGCTGTCCAGAGCGAT
CCCAGGACCTCGATCTACACTTCCAAGTTTGCTCAGAACCAGGGATTGTTCTTCGACACATTCTCGCGAGCGTTTGTCAAGCTCACCAGCGTCGTCAACTCGGAAGCCACGCAGGTTCGA
TCGAATTGCCGCGCGATCAACTCGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCTTTCGCGTTGCTTCTCCTCCTCCTCCTCGCAATCTCTTGCCGCGCAGTGGATCAGGAGTCGTCACCGCGGGCGCAAGCTCTGGGAAATTCCACTTCCACCTCACTGCGATTG
GGATACTACGGATCCAGCTGCCCCAATGCCGAGACCATCGTGCGCCAGACGCTCATGACGCTCCTCATGCAAGATCCCACCGCTGGAGCGGCATTGCTTCGCCTCGCCTTCCACGATTGC
GATGTCATG
GGCTGCGATGCATCGATCATCTTGGATTCCACTGCACAGTTTCAGAGCGAGCTGGAATCTCCCAAGAACTTTGGCATTCGTCGCGTGGATTTCATCGATAGGATCAAGGCG
TCGTTGGAGGGGAGCTGCCCGCGCACTGTCTCTTGCGCTGACATCATCGCTCTAGCTGCTCGAGACTCCATCTTGCTG
GCTGGAGGACCAAACATTCCTGTTCTAACGGGTCGCAAAGAT
AGCACGAGAGCGGACCTCGCTACCGCTAATCGCAAGCTTGCCACTGCCACTTCTTCCGTGGAGGAAATTCTCCAAGACTTCGCGTCCATGGGAATTAACCCGCAAGAGGCTGTGTCTCTT
CTCG
GAGCTCACACTCTTGGAGTTGGGCACTGCTTGAGCGTTGTCAACCGGCTCTATCCAAGCGTTGATACCAAGATGGATCTCATGTACTCGATGGCGTTGCGAGTGTTGTGCCCGAGT
CCAAAGTTCTACCTCAACATCACGGCCATCCCAAACGATTCAACCATGTTTAGATTCGACAACATGTTCTTCAAGGACGCTGCCTCGCGGCGGGTGCTCTTCGCGCTTGATGCCGCTGTC
CAGAGCGATCCCAGGACCTCGATCTACACTTCCAAGTTTGCTCAGAACCAGGGATTGTTCTTCGACACATTCTCGCGAGCGTTTGTCAAGCTCACCAGCGTCGTCAACTCGGAAGCCACG
CAGGTTCGATCGAATTGCCGCGCGATCAACTCGTAG

Retrieve as FASTA