Entry information : SmPrx77-1_52 (SmPrx77a_52)
Entry ID 7065
Creation 2009-10-19 (Paula Nunes)
Last sequence changes 2009-10-19 (Paula Nunes)
Sequence status complete
Reviewer Toky Ramarohetra
Last annotation changes 2011-02-01 (Toky Ramarohetra)
Peroxidase information: SmPrx77-1_52 (SmPrx77a_52)
Name (synonym) SmPrx77-1_52 (SmPrx77a_52)
Class Class III peroxidase    [Orthogroup: Prx029]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx77-1_52
start..stop
S start..stop
SmPrx77-2_155 667 0 1..330 1..330
GbPrx53 390 5e-137 26..327 30..330
PtaPrx97 373 3e-130 30..327 30..326
PabPrx206 372 2e-129 31..327 39..334
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1123042..1123272 231 N° 2 1123348..1123536 189 N° 3 1123620..1123785 166 N° 4 1123851..1124257 407
join(1123042..1123272,1123348..1123536,1123620..1123785,1123851..1124257)


exon

Literature and cross-references SmPrx77-1_52 (SmPrx77a_52)
DNA ref. Phytozome 12:   scaffold_52 (1123042..1124254)
mRNA ref. JGI transcript:   138552 [Incorrect prediction]   179387 [Incorrect prediction]
Protein sequence: SmPrx77-1_52 (SmPrx77a_52)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (311)
PWM (Da):   %s   35828.93 (33869.8)  
PI (pH):   %s   4.83 (4.83) Peptide Signal:   %s   cut: 20 range:20-330
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLAILLMLSLLGSLSFANAQESSSGGDGGSGLKHKFYALSCPQAEDIARRTLQRNRMSDPTAPAALLRVVFHDCQVEGCDASILLETSSAMTAETVSEKNFSIRRLDYIHDIKAAIEKECPGIVSCADIIVMAARDAIAMSGGPQIPIETGRRDTLFASNLNADEALPPPTLTVSEMLDTLAEKGLDIEESVAILGAHTLGVGHCLNFINRFDPQDNGPQMSPFFSTALRVLCQSPPSMSNATFAPNDLTNFMFDNQYFRDLQGQRGLLTVDAELPIDPRTKKHVDLFALNQLLFFAKFSDAFVKLTSFNVLTGSDGEIRRDCRAVNREP

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No ESTs. Incorrect protein sequence prediction (short 5' is missing). Same sequence in scaffold 52 and 252.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGGCGATTTTGCTGATGTTGTCGCTCCTGGGAAGCTTAAGCTTTGCCAATGCTCAGGAATCATCAAGCGGCGGCGATGGTGGCAGTGGGCTCAAGCACAAATTCTACGCGCTCTCG
TGCCCCCAGGCAGAGGATATTGCTCGAAGAACGCTCCAACGAAACAGGATGAGCGATCCCACCGCCCCTGCGGCGCTCCTCCGCGTCGTCTTCCATGATTGCCAGGTTGAG
GTACGTGAT
TGCGGTGATCGTGACGATTCTTGAGAGGAAATGAGGGAAAAGAAAGCTCTCGACTTGCTTTTGCAGGGATGCGATGCTTCGATTCTACTCGAGACATCTTCCGCGATGACCGCCGAGACC
GTGTCGGAGAAGAATTTCTCCATTCGCCGCTTGGATTACATTCACGACATCAAGGCCGCCATTGAAAAGGAATGCCCCGGCATCGTCTCTTGCGCCGACATCATCGTTATGGCTGCCAGG
GACGCCATCGCAATG
GTGTGGGGATCTTTTCTTGTTCGATCGATCGATCGATCAGCTTGAGTTGAGGAACTTCTAACACTTTGCTCTTGATCTTGCAGTCTGGTGGTCCACAAATCCCGA
TCGAAACTGGGCGAAGAGACACTCTCTTCGCCAGTAACTTAAACGCGGACGAAGCGCTGCCCCCTCCAACATTGACCGTGAGTGAGATGCTCGACACTCTCGCGGAAAAAGGCCTTGACA
TCGAAGAGAGCGTCGCCATCTTAG
GTAAGAAAACCATCCCAATCCCATGTCCGCATCGATCGATCATGGATTGGTCGATTTCTTGGCAGGAGCTCACACATTGGGCGTTGGGCACTGCCT
GAATTTCATCAATCGCTTCGATCCCCAGGACAATGGCCCCCAGATGTCGCCCTTCTTCTCCACGGCGCTCAGGGTCTTGTGCCAATCACCCCCTTCGATGAGCAATGCCACATTCGCGCC
CAACGATCTCACCAATTTCATGTTTGACAACCAGTACTTCCGCGATCTGCAAGGCCAGCGCGGATTGCTCACCGTGGACGCGGAGCTCCCCATCGATCCACGCACCAAGAAGCATGTCGA
TCTCTTCGCGCTCAATCAGCTCCTCTTCTTCGCCAAATTCAGCGACGCCTTCGTCAAGCTCACCAGCTTCAATGTGCTCACGGGCAGCGATGGTGAGATTCGGAGGGATTGCCGGGCTGT
GAATCGAGAGCCCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGGCGATTTTGCTGATGTTGTCGCTCCTGGGAAGCTTAAGCTTTGCCAATGCTCAGGAATCATCAAGCGGCGGCGATGGTGGCAGTGGGCTCAAGCACAAATTCTACGCGCTCTCG
TGCCCCCAGGCAGAGGATATTGCTCGAAGAACGCTCCAACGAAACAGGATGAGCGATCCCACCGCCCCTGCGGCGCTCCTCCGCGTCGTCTTCCATGATTGCCAGGTTGAG
GGATGCGAT
GCTTCGATTCTACTCGAGACATCTTCCGCGATGACCGCCGAGACCGTGTCGGAGAAGAATTTCTCCATTCGCCGCTTGGATTACATTCACGACATCAAGGCCGCCATTGAAAAGGAATGC
CCCGGCATCGTCTCTTGCGCCGACATCATCGTTATGGCTGCCAGGGACGCCATCGCAATG
TCTGGTGGTCCACAAATCCCGATCGAAACTGGGCGAAGAGACACTCTCTTCGCCAGTAAC
TTAAACGCGGACGAAGCGCTGCCCCCTCCAACATTGACCGTGAGTGAGATGCTCGACACTCTCGCGGAAAAAGGCCTTGACATCGAAGAGAGCGTCGCCATCTTAG
GAGCTCACACATTG
GGCGTTGGGCACTGCCTGAATTTCATCAATCGCTTCGATCCCCAGGACAATGGCCCCCAGATGTCGCCCTTCTTCTCCACGGCGCTCAGGGTCTTGTGCCAATCACCCCCTTCGATGAGC
AATGCCACATTCGCGCCCAACGATCTCACCAATTTCATGTTTGACAACCAGTACTTCCGCGATCTGCAAGGCCAGCGCGGATTGCTCACCGTGGACGCGGAGCTCCCCATCGATCCACGC
ACCAAGAAGCATGTCGATCTCTTCGCGCTCAATCAGCTCCTCTTCTTCGCCAAATTCAGCGACGCCTTCGTCAAGCTCACCAGCTTCAATGTGCTCACGGGCAGCGATGGTGAGATTCGG
AGGGATTGCCGGGCTGTGAATCGAGAGCCCTAG

Retrieve as FASTA