Entry information : SmPrx37-1_2 (SmPrx37a_2)
Entry ID 7072
Creation 2009-10-19 (Paula Nunes)
Last sequence changes 2009-10-19 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx37-1_2 (SmPrx37a_2)
Name (synonym) SmPrx37-1_2 (SmPrx37a_2)
Class Class III peroxidase    [Orthogroup: Prx078]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx37-1_2
start..stop
S start..stop
SmPrx37-2_44 643 0 1..341 4..343
SmPrx36-2_44 471 4e-168 34..341 70..376
SmPrx36-1_2 471 8e-168 34..341 70..376
SmPrx50-1_126 405 1e-142 18..340 6..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3175765..3176016 252 N° 2 3176115..3176306 192 N° 3 3176356..3176937 582  
join(3175765..3176016,3176115..3176306,3176356..3176937)


exon

Literature and cross-references SmPrx37-1_2 (SmPrx37a_2)
DNA ref. Phytozome 12:   scaffold_2 (3175765..3176937)
mRNA ref. JGI transcript:   230146
Protein sequence: SmPrx37-1_2 (SmPrx37a_2)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   341 (312)
PWM (Da):   %s   36646.16 (33687.6)  
PI (pH):   %s   6.24 (6.02) Peptide Signal:   %s   cut: 30 range:30-341
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAASTNKESALLLTLVALHLSLFSSCVSAHPPSSSSFPLSPTFYAYSCPNLLSIVRGVLSRAVEREPRMAASLLRLHFHDCFVMGCDGSVLLDDQPGFTGEKTSNPNRNSARGFEVVDDVKAAVESACPGVVSCADVLAIIAEQSVELTYGPSWTVLLGRRDSTTASLSGSNNDIPPPTSTLAQLIASFQRKGLSVQDLVALSGSHTIGNARCTSFRDRLYNFSNTGRPDPSLDQGYLRELQARCPPSGGDNNIFNLDLHTPTEFDTSYFTNLKFSKGLLNSDQVLFSTPGASTKNLVSTYDFAQDNFFNDFAVSMVKMGNLNPLTGTNGEIRKNCRVVNS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCGTCGACGAACAAGGAGAGTGCGCTGTTGCTGACTTTGGTGGCCTTGCATCTGTCGCTATTTTCTTCCTGTGTGTCTGCCCATCCGCCTTCTTCTTCTTCTTTCCCGCTGAGC
CCCACTTTCTACGCTTACTCGTGCCCGAATCTCTTGTCCATCGTGAGAGGTGTTCTCTCTAGAGCCGTGGAGCGAGAGCCAAGGATGGCGGCCTCGCTCCTCCGCCTGCATTTCCACGAC
TGCTTTGTCATG
GTAAGGAACAAACGCTTTTTCGTTTTGTACCTCTTTAAGAGAAGAAGTTGGCACTGCGCGGAAACGTTTCTAATTTTTGTTGTTGATGTTGTTGTCAGGGGTGCGATG
GATCTGTTCTTCTCGACGACCAGCCGGGCTTCACCGGCGAGAAGACGTCCAATCCGAACAGAAACTCCGCCAGAGGCTTTGAGGTTGTGGACGACGTGAAAGCCGCGGTGGAAAGCGCCT
GCCCCGGAGTCGTGTCTTGCGCCGACGTGCTCGCTATCATCGCTGAGCAAAGCGTGGAACTG
GTAAGAACAGTGTCGTGAGATAAAAGAAAGCTTACTTTTCGAGATGCAGACTTACGGG
CCTTCCTGGACGGTGCTCCTGGGACGTAGAGACAGCACCACAGCGAGCTTATCCGGCTCTAACAACGATATACCACCTCCCACGTCCACGCTCGCCCAGCTTATCGCCAGCTTCCAGCGG
AAAGGACTCTCCGTGCAGGATCTCGTCGCTCTGTCGGGCTCGCATACCATTGGAAACGCTCGTTGCACCAGCTTCAGGGACCGGCTATACAACTTCAGTAACACCGGTCGTCCCGATCCA
AGCCTCGACCAAGGATACTTGAGAGAGCTGCAGGCAAGATGCCCACCGTCAGGAGGTGACAACAACATTTTCAACCTGGATTTGCATACCCCGACCGAGTTCGATACGTCCTACTTCACC
AATCTCAAGTTTAGCAAGGGCCTCCTCAACTCTGATCAGGTCCTGTTTAGCACTCCCGGAGCCAGCACCAAGAACTTAGTGAGCACCTACGACTTTGCTCAAGATAATTTCTTCAATGAC
TTTGCAGTTTCCATGGTGAAGATGGGAAACTTGAACCCTCTCACTGGTACCAACGGTGAGATTCGGAAAAACTGCCGAGTCGTAAACAGCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCGTCGACGAACAAGGAGAGTGCGCTGTTGCTGACTTTGGTGGCCTTGCATCTGTCGCTATTTTCTTCCTGTGTGTCTGCCCATCCGCCTTCTTCTTCTTCTTTCCCGCTGAGC
CCCACTTTCTACGCTTACTCGTGCCCGAATCTCTTGTCCATCGTGAGAGGTGTTCTCTCTAGAGCCGTGGAGCGAGAGCCAAGGATGGCGGCCTCGCTCCTCCGCCTGCATTTCCACGAC
TGCTTTGTCATG
GGGTGCGATGGATCTGTTCTTCTCGACGACCAGCCGGGCTTCACCGGCGAGAAGACGTCCAATCCGAACAGAAACTCCGCCAGAGGCTTTGAGGTTGTGGACGACGTG
AAAGCCGCGGTGGAAAGCGCCTGCCCCGGAGTCGTGTCTTGCGCCGACGTGCTCGCTATCATCGCTGAGCAAAGCGTGGAACTG
ACTTACGGGCCTTCCTGGACGGTGCTCCTGGGACGT
AGAGACAGCACCACAGCGAGCTTATCCGGCTCTAACAACGATATACCACCTCCCACGTCCACGCTCGCCCAGCTTATCGCCAGCTTCCAGCGGAAAGGACTCTCCGTGCAGGATCTCGTC
GCTCTGTCGGGCTCGCATACCATTGGAAACGCTCGTTGCACCAGCTTCAGGGACCGGCTATACAACTTCAGTAACACCGGTCGTCCCGATCCAAGCCTCGACCAAGGATACTTGAGAGAG
CTGCAGGCAAGATGCCCACCGTCAGGAGGTGACAACAACATTTTCAACCTGGATTTGCATACCCCGACCGAGTTCGATACGTCCTACTTCACCAATCTCAAGTTTAGCAAGGGCCTCCTC
AACTCTGATCAGGTCCTGTTTAGCACTCCCGGAGCCAGCACCAAGAACTTAGTGAGCACCTACGACTTTGCTCAAGATAATTTCTTCAATGACTTTGCAGTTTCCATGGTGAAGATGGGA
AACTTGAACCCTCTCACTGGTACCAACGGTGAGATTCGGAAAAACTGCCGAGTCGTAAACAGCTGA

Retrieve as FASTA