Entry information : SmPrx37-2_44 (SmPrx37b_44)
Entry ID 7073
Creation 2009-10-19 (Paula Nunes)
Last sequence changes 2009-10-19 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx37-2_44 (SmPrx37b_44)
Name (synonym) SmPrx37-2_44 (SmPrx37b_44)
Class Class III peroxidase    [Orthogroup: Prx078]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx37-2_44
start..stop
S start..stop
SmPrx37-1_2 635 0 4..343 1..341
SmPrx36-2_44 471 4e-168 36..343 70..376
SmPrx36-1_2 471 6e-168 36..343 70..376
SmPrx50-1_126 405 1e-142 21..342 6..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1225842..1226099 258 N° 2 1225552..1225743 192 N° 3 1224921..1225502 582  
complement(join(1224921..1225502,1225552..1225743,1225842..1226099))


exon

Literature and cross-references SmPrx37-2_44 (SmPrx37b_44)
DNA ref. Phytozome 12:   scaffold_44 (1226099..1224921)
mRNA ref. JGI transcript:   444510
EST ref. GenBank:   FE475032.1 [5' end]   FE475031.1 [3' end]
Protein sequence: SmPrx37-2_44 (SmPrx37b_44)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   343 (311)
PWM (Da):   %s   36975.36 (33573.6) Transmb domain:   %s   i13-35o
PI (pH):   %s   6.76 (6.02) Peptide Signal:   %s   cut: 33 range:33-343
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MRRMAASTNKESALLLTLVALHLSLFSSCVSAHPPSSSFPLSPTFYAYSCPNLLSIVRGVLSRAVEREPRMAASLLRLHFHDCFVMGCDGSVLLDDQPGFTGEKTSNPNRNSARGFEVVDDVKAAVESACPGVVSCADVLAIIAEQSVELTYGPSWTVLLGRRDSTTASLSGSNNDIPPPTSTLAQLIASFQRKGLSVQDLVALSGSHTIGNARCTSFRDRLYNFSNTGRPDPSLDQGYLRELQARCPPSGGDNNIFNLDLHTPTEFDTSYFTNLKFSKGLLNSDQVLFSTPGASTKNLVSTYDFAQDSFFNDFAVSMVKMGNLNPLTGTNGEIRKNCRVVNS*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2) and 2 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAAGAATGGCGGCGTCGACGAACAAGGAGAGTGCGCTGTTGCTGACTTTGGTGGCCTTGCATCTGTCGCTATTTTCTTCCTGTGTGTCTGCCCATCCGCCTTCTTCTTCTTTCCCG
CTGAGCCCCACTTTCTACGCTTACTCGTGCCCGAATCTCTTGTCCATCGTGAGAGGCGTTCTCTCTAGAGCTGTGGAGCGAGAGCCAAGGATGGCGGCCTCGCTCCTCCGCCTGCATTTC
CACGACTGCTTTGTCATG
GTAAGGAACAAACGCTTTTTCGTTTTGTACCTCTTTAAGAGAAGAAGTTGGCACTGCGCGGAAACGTTTCTAATTTTTGTTGTTGATGTTGTTGTCAGGGGT
GCGATGGATCTGTTCTTCTCGACGACCAGCCGGGCTTCACCGGCGAGAAGACGTCCAATCCGAACAGAAACTCCGCCAGAGGCTTTGAGGTTGTGGACGACGTGAAAGCCGCGGTGGAAA
GCGCCTGCCCCGGAGTCGTGTCTTGCGCCGACGTGCTCGCTATCATCGCTGAGCAAAGCGTGGAACTG
GTAAGAACAGTGTCGTGAGATAAAAGAAAGCTTACTTTTCGAGATGCAGACT
TACGGGCCTTCCTGGACGGTGCTCCTGGGACGTAGAGACAGCACCACAGCGAGCTTATCCGGCTCTAACAACGATATACCACCTCCCACGTCCACGCTCGCCCAGCTTATCGCCAGCTTC
CAGCGGAAAGGACTCTCCGTGCAGGATCTCGTCGCTCTGTCGGGCTCGCATACCATTGGAAATGCTCGTTGCACCAGCTTCAGGGACCGGCTATACAACTTCAGTAACACCGGTCGTCCC
GATCCAAGCCTCGACCAAGGATACTTGAGAGAGCTGCAGGCAAGATGTCCACCGTCAGGAGGTGACAACAACATTTTCAACCTGGATTTGCATACCCCGACCGAGTTCGATACGTCCTAC
TTCACCAATCTCAAGTTTAGCAAGGGCCTCCTCAACTCTGATCAGGTCCTGTTTAGCACTCCCGGAGCCAGCACCAAGAACTTAGTGAGCACCTACGACTTTGCTCAGGATAGTTTCTTC
AATGACTTTGCAGTTTCCATGGTGAAGATGGGAAACTTGAACCCTCTCACTGGTACCAACGGTGAGATTCGGAAAAACTGCCGAGTCGTAAACAGCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGAAGAATGGCGGCGTCGACGAACAAGGAGAGTGCGCTGTTGCTGACTTTGGTGGCCTTGCATCTGTCGCTATTTTCTTCCTGTGTGTCTGCCCATCCGCCTTCTTCTTCTTTCCCG
CTGAGCCCCACTTTCTACGCTTACTCGTGCCCGAATCTCTTGTCCATCGTGAGAGGCGTTCTCTCTAGAGCTGTGGAGCGAGAGCCAAGGATGGCGGCCTCGCTCCTCCGCCTGCATTTC
CACGACTGCTTTGTCATG
GGGTGCGATGGATCTGTTCTTCTCGACGACCAGCCGGGCTTCACCGGCGAGAAGACGTCCAATCCGAACAGAAACTCCGCCAGAGGCTTTGAGGTTGTGGAC
GACGTGAAAGCCGCGGTGGAAAGCGCCTGCCCCGGAGTCGTGTCTTGCGCCGACGTGCTCGCTATCATCGCTGAGCAAAGCGTGGAACTG
ACTTACGGGCCTTCCTGGACGGTGCTCCTG
GGACGTAGAGACAGCACCACAGCGAGCTTATCCGGCTCTAACAACGATATACCACCTCCCACGTCCACGCTCGCCCAGCTTATCGCCAGCTTCCAGCGGAAAGGACTCTCCGTGCAGGAT
CTCGTCGCTCTGTCGGGCTCGCATACCATTGGAAATGCTCGTTGCACCAGCTTCAGGGACCGGCTATACAACTTCAGTAACACCGGTCGTCCCGATCCAAGCCTCGACCAAGGATACTTG
AGAGAGCTGCAGGCAAGATGTCCACCGTCAGGAGGTGACAACAACATTTTCAACCTGGATTTGCATACCCCGACCGAGTTCGATACGTCCTACTTCACCAATCTCAAGTTTAGCAAGGGC
CTCCTCAACTCTGATCAGGTCCTGTTTAGCACTCCCGGAGCCAGCACCAAGAACTTAGTGAGCACCTACGACTTTGCTCAGGATAGTTTCTTCAATGACTTTGCAGTTTCCATGGTGAAG
ATGGGAAACTTGAACCCTCTCACTGGTACCAACGGTGAGATTCGGAAAAACTGCCGAGTCGTAAACAGCTGA

Retrieve as FASTA