Entry information : SmPrx79-2_12 (SmPrx79b_12)
Entry ID 7079
Creation 2009-10-22 (Paula Nunes)
Last sequence changes 2009-10-22 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx79-2_12 (SmPrx79b_12)
Name (synonym) SmPrx79-2_12 (SmPrx79b_12)
Class Class III peroxidase    [Orthogroup: Prx290]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx79-2_12
start..stop
S start..stop
SmPrx79-1_15 658 0 1..322 1..322
SmPrx36-2_44 367 4e-127 4..319 60..375
SmPrx36-1_2 367 4e-127 4..319 60..375
GbPrx04 359 1e-124 3..319 8..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1800112..1800303 192 N° 2 1799864..1800055 192 N° 3 1799642..1799807 166 N° 4 1799171..1799589 419
complement(join(1799171..1799589,1799642..1799807,1799864..1800055,1800112..1800 303))


exon

Literature and cross-references SmPrx79-2_12 (SmPrx79b_12)
DNA ref. Phytozome 12:   scaffold_12 (1800303..1799171)
mRNA ref. JGI transcript:   92054 [Fragment]
Protein sequence: SmPrx79-2_12 (SmPrx79b_12)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (304)
PWM (Da):   %s   35431.24 (33540.2)  
PI (pH):   %s   9.77 (9.77) Peptide Signal:   %s   cut: 19 range:19-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKLFVITVMAALQCASLALSPDFYSESCPEARATVLGVLKKALKRDKRMAASLLRLHFHDCFVNGCDGSVLLDDFPGFTGEKTALPNANSLRGFEVVDEMKAALERNCPGVVSCADILALAAQLSVEMRGGPRWSVEVGRRDALSASRITANNDIPPPTSNVSTLVSLFQKQGLSVRDMVILSGSHTLGLARCTTFKPRIYNHTGTLRADPEFGRELLVRSRIHCPRFGHGNQTLALDYQSPHRFDNYYFRNLLERKALLNSDQVLTYQSPLTRALVTKYAYDQPTFFAHFAASMIRMGGIRPLTGAAGQVRRSCRAINRVR

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No ESTs. Incorrect prediction from JGI transcript.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCTCTTTGTGATTACTGTCATGGCTGCTTTGCAATGCGCTAGTCTTGCACTGAGCCCCGACTTCTATAGCGAGTCCTGCCCGGAAGCTCGGGCCACGGTCCTCGGTGTGTTGAAG
AAAGCCTTGAAGCGAGACAAGAGGATGGCGGCATCGTTGCTTCGTCTCCACTTCCACGACTGCTTCGTCAAC
GTAAGTAGTGTCCCTGGCATTGTGATGGATCATCCACACAACCTCTTG
TGCGGCAGGGCTGCGACGGCTCCGTGTTGCTGGATGACTTTCCGGGCTTCACTGGAGAGAAGACGGCACTCCCAAACGCAAACTCGCTGCGCGGATTCGAGGTTGTAGATGAGATGAAAG
CGGCGCTGGAGAGGAACTGCCCGGGCGTTGTGTCGTGCGCGGACATCCTCGCACTCGCTGCTCAGCTCTCCGTTGAGATG
GTAACTGTATAGCGTTGTTCTTCCAAGCTCACGGGTGGTA
AAAGCGATGGATGCAGAGGGGCGGGCCGAGATGGAGTGTGGAGGTGGGAAGAAGGGACGCGTTGAGCGCGAGCCGCATTACCGCAAACAACGACATCCCCCCGCCAACGTCCAACGTCTC
GACGCTGGTGTCCCTGTTCCAGAAGCAAGGGCTGTCGGTCCGAGACATGGTGATCCTCTCAG
GTTCGTGAGCCCTTCCAAGGTGTAACTTGTGACGACGCTCCCAGTCTGGCAGGTAGCC
ACACACTGGGGCTGGCACGCTGCACCACCTTCAAGCCCCGGATCTACAACCACACGGGAACGCTGCGTGCCGACCCCGAGTTCGGCAGGGAGCTGCTGGTACGCTCCCGAATCCACTGCC
CGCGCTTTGGCCACGGCAACCAGACGCTGGCGCTCGACTACCAGTCCCCGCATCGCTTCGACAACTACTACTTCCGCAACCTCCTGGAGCGCAAGGCCCTCCTCAACTCGGACCAGGTGC
TCACGTACCAGTCGCCGCTCACCCGCGCGCTCGTCACCAAGTACGCCTACGACCAGCCCACCTTCTTCGCGCATTTCGCCGCGTCCATGATCCGGATGGGAGGCATCAGGCCGCTCACGG
GCGCCGCCGGACAGGTCCGGCGGAGCTGCCGCGCGATCAACAGGGTGCGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGCTCTTTGTGATTACTGTCATGGCTGCTTTGCAATGCGCTAGTCTTGCACTGAGCCCCGACTTCTATAGCGAGTCCTGCCCGGAAGCTCGGGCCACGGTCCTCGGTGTGTTGAAG
AAAGCCTTGAAGCGAGACAAGAGGATGGCGGCATCGTTGCTTCGTCTCCACTTCCACGACTGCTTCGTCAAC
GGCTGCGACGGCTCCGTGTTGCTGGATGACTTTCCGGGCTTCACTGGA
GAGAAGACGGCACTCCCAAACGCAAACTCGCTGCGCGGATTCGAGGTTGTAGATGAGATGAAAGCGGCGCTGGAGAGGAACTGCCCGGGCGTTGTGTCGTGCGCGGACATCCTCGCACTC
GCTGCTCAGCTCTCCGTTGAGATG
AGGGGCGGGCCGAGATGGAGTGTGGAGGTGGGAAGAAGGGACGCGTTGAGCGCGAGCCGCATTACCGCAAACAACGACATCCCCCCGCCAACGTCC
AACGTCTCGACGCTGGTGTCCCTGTTCCAGAAGCAAGGGCTGTCGGTCCGAGACATGGTGATCCTCTCAG
GTAGCCACACACTGGGGCTGGCACGCTGCACCACCTTCAAGCCCCGGATC
TACAACCACACGGGAACGCTGCGTGCCGACCCCGAGTTCGGCAGGGAGCTGCTGGTACGCTCCCGAATCCACTGCCCGCGCTTTGGCCACGGCAACCAGACGCTGGCGCTCGACTACCAG
TCCCCGCATCGCTTCGACAACTACTACTTCCGCAACCTCCTGGAGCGCAAGGCCCTCCTCAACTCGGACCAGGTGCTCACGTACCAGTCGCCGCTCACCCGCGCGCTCGTCACCAAGTAC
GCCTACGACCAGCCCACCTTCTTCGCGCATTTCGCCGCGTCCATGATCCGGATGGGAGGCATCAGGCCGCTCACGGGCGCCGCCGGACAGGTCCGGCGGAGCTGCCGCGCGATCAACAGG
GTGCGCTAG

Retrieve as FASTA