Entry information : SmPrx60-2_61 (SmPrx60b_61)
Entry ID 7089
Creation 2009-10-22 (Paula Nunes)
Last sequence changes 2009-10-22 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx60-2_61 (SmPrx60b_61)
Name (synonym) SmPrx60-2_61 (SmPrx60b_61)
Class Class III peroxidase    [Orthogroup: Prx007]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx60-2_61
start..stop
S start..stop
SmPrx60-1_19 642 0 1..316 1..316
RcPrx09 393 2e-138 1..316 1..321
GbPrx27 390 4e-137 17..316 32..337
HaPrx09 389 1e-136 3..316 6..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1177902..1178102 201 N° 2 1178167..1178346 180 N° 3 1178420..1178582 163 N° 4 1178635..1179041 407
join(1177902..1178102,1178167..1178346,1178420..1178582,1178635..1179041)


exon

Literature and cross-references SmPrx60-2_61 (SmPrx60b_61)
DNA ref. Phytozome 12:   scaffold_61 (1177902..1179041)
mRNA ref. JGI transcript:   234501
Protein sequence: SmPrx60-2_61 (SmPrx60b_61)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   316 (296)
PWM (Da):   %s   33180.61 (31124.5)  
PI (pH):   %s   6.88 (7.70) Peptide Signal:   %s   cut: 21 range:21-316
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MELTVLALLIVAAAYNLAEGATRIGFYDGSCPRVEAIVKSTVRSHMSSNPMIGAGVLRLHFHDCFVRGCDGSILIDGPSAEKAALANLGLRGFEVIDDAKRQIEAACPGVVSCADILALAARDAVSESGGQFWPVPLGRRDGRVSSASDASNMPSPLDSVAVLKQKFSAKGLTTLDLATLSGAHTIGQTDCRFFSYRLYNFSSTGKPDPSMSQSTLAMLQQQCPRGDAGLNKVALDTGSQGSFDSSYFKNLRNGGGVLESDQRLMDDTGARITVTAFGVAGVTFRAGFVASMLRMSDIQVLTGSDGEIRRACNAVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCTCACGGTTTTGGCGTTGCTCATAGTCGCGGCGGCTTACAATCTTGCAGAAGGTGCGACGAGGATTGGATTCTACGACGGCTCGTGCCCTCGAGTGGAAGCCATCGTCAAGTCC
ACAGTGAGATCACACATGAGCTCCAATCCTATGATTGGAGCAGGCGTTCTTCGCTTGCATTTCCACGACTGCTTTGTCCGA
GTGGGTTTGAAGCTCGTTTGAAGCTTTGATTTGATCCTG
AGCTTCCGTCCGCTCGTTTCTTCAGGGCTGTGATGGCTCCATTCTCATCGACGGCCCGAGCGCGGAGAAAGCGGCGCTGGCCAACCTCGGCCTCCGGGGCTTCGAAGTTATAGACGATGC
GAAGCGGCAGATCGAGGCAGCGTGTCCGGGAGTTGTGTCGTGCGCCGACATTCTTGCGCTCGCTGCCAGGGACGCGGTCTCAGAG
GTATCAAATCACGAACTTTCGATCGTCAGCTATTA
TAACAATCCGTGCGCTGTGTCTTGATCAATGACCTTAGAGTGGAGGACAGTTCTGGCCAGTTCCTCTGGGCCGACGGGACGGAAGAGTTTCCTCTGCCTCGGACGCATCAAACATGCCCT
CGCCACTCGACTCGGTCGCGGTGCTCAAGCAAAAGTTCTCGGCCAAAGGACTCACAACTCTGGATCTCGCAACTCTCAGTG
GTACGTAAAATCACTCGAGCTTTCTCGATCAATCGACAA
ATCTGCCATACAGGTGCTCACACGATCGGCCAGACCGACTGCCGCTTTTTCAGCTACCGCCTCTACAACTTCTCGTCCACCGGCAAGCCGGATCCATCCATGAGCCAGAGCACTCTCGCT
ATGCTCCAGCAGCAGTGTCCCAGGGGTGACGCGGGGCTCAACAAGGTGGCGCTGGACACGGGCAGCCAGGGCTCGTTCGACAGCAGCTACTTCAAGAACTTGCGGAATGGTGGCGGGGTG
CTGGAGTCGGACCAGCGCCTCATGGACGACACCGGGGCGCGCATCACGGTGACGGCGTTTGGAGTGGCCGGGGTGACGTTCCGGGCGGGGTTCGTGGCGTCCATGCTCCGGATGAGCGAC
ATACAGGTGCTCACTGGGAGTGATGGAGAGATTAGAAGAGCTTGCAATGCAGTGAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCTCACGGTTTTGGCGTTGCTCATAGTCGCGGCGGCTTACAATCTTGCAGAAGGTGCGACGAGGATTGGATTCTACGACGGCTCGTGCCCTCGAGTGGAAGCCATCGTCAAGTCC
ACAGTGAGATCACACATGAGCTCCAATCCTATGATTGGAGCAGGCGTTCTTCGCTTGCATTTCCACGACTGCTTTGTCCGA
GGCTGTGATGGCTCCATTCTCATCGACGGCCCGAGCGCG
GAGAAAGCGGCGCTGGCCAACCTCGGCCTCCGGGGCTTCGAAGTTATAGACGATGCGAAGCGGCAGATCGAGGCAGCGTGTCCGGGAGTTGTGTCGTGCGCCGACATTCTTGCGCTCGCT
GCCAGGGACGCGGTCTCAGAG
AGTGGAGGACAGTTCTGGCCAGTTCCTCTGGGCCGACGGGACGGAAGAGTTTCCTCTGCCTCGGACGCATCAAACATGCCCTCGCCACTCGACTCGGTC
GCGGTGCTCAAGCAAAAGTTCTCGGCCAAAGGACTCACAACTCTGGATCTCGCAACTCTCAGTG
GTGCTCACACGATCGGCCAGACCGACTGCCGCTTTTTCAGCTACCGCCTCTACAAC
TTCTCGTCCACCGGCAAGCCGGATCCATCCATGAGCCAGAGCACTCTCGCTATGCTCCAGCAGCAGTGTCCCAGGGGTGACGCGGGGCTCAACAAGGTGGCGCTGGACACGGGCAGCCAG
GGCTCGTTCGACAGCAGCTACTTCAAGAACTTGCGGAATGGTGGCGGGGTGCTGGAGTCGGACCAGCGCCTCATGGACGACACCGGGGCGCGCATCACGGTGACGGCGTTTGGAGTGGCC
GGGGTGACGTTCCGGGCGGGGTTCGTGGCGTCCATGCTCCGGATGAGCGACATACAGGTGCTCACTGGGAGTGATGGAGAGATTAGAAGAGCTTGCAATGCAGTGAATTGA

Retrieve as FASTA