Entry information : SmPrx60-1_19 (SmPrx60a_19)
Entry ID 7090
Creation 2009-10-22 (Paula Nunes)
Last sequence changes 2009-10-22 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx60-1_19 (SmPrx60a_19)
Name (synonym) SmPrx60-1_19 (SmPrx60a_19)
Class Class III peroxidase    [Orthogroup: Prx007]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx60-1_19
start..stop
S start..stop
SmPrx60-2_61 642 0 1..316 1..316
RcPrx09 392 8e-138 1..316 1..321
GbPrx27 389 2e-136 17..316 32..337
HaPrx09 388 3e-136 3..316 6..324
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 964578..964778 201 N° 2 964843..965022 180 N° 3 965088..965250 163 N° 4 965303..965709 407
join(964578..964778,964843..965022,965088..965250,965303..965709)


exon

Literature and cross-references SmPrx60-1_19 (SmPrx60a_19)
DNA ref. Phytozome 12:   scaffold_19 (964578..965709)
mRNA ref. JGI transcript:   97402
Protein sequence: SmPrx60-1_19 (SmPrx60a_19)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   316 (296)
PWM (Da):   %s   33180.57 (31124.4)  
PI (pH):   %s   6.5 (7.31) Peptide Signal:   %s   cut: 21 range:21-316
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MELTVLALLIVAAAYNLAEGATRIGFYDGSCPRVEAIVKSTVRSHMSSNPMIGAGVLRLHFHDCFVRGCDGSILIDGPSAEKAALANLGLRGFEVIDDAKRQIEAACPGVVSCADILALAARDAVSESGGQFWPVPLGRRDGRVSSASDASNMPSPLDSVAVLKQKFSAKGLTTLDLATLSGAHTIGQTDCRFFSYRLYNFSSTGKPDPSMSQSTLAMLQQQCPRGDAGLNKVALDTGSQGSFDSSYFQNLRNGGGVLESDQRLMDDTGARITVTAFGVAGVTFRAGFVASMLRMSDIQVLTGSDGEIRRACNAVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCTCACGGTTTTGGCGTTGCTCATAGTCGCGGCGGCTTACAATCTTGCAGAAGGTGCGACGAGGATTGGATTCTACGACGGCTCGTGCCCTCGAGTGGAAGCCATCGTTAAGTCC
ACAGTGAGATCACACATGAGCTCCAATCCTATGATTGGAGCCGGCGTTCTTCGCTTGCATTTCCACGACTGCTTTGTCCGA
GTGGGTTTGAAGCTCGTTTGAAGCTTTGATTTGATCCTG
AGCTTCCGTCCGCTCGTTTCTACAGGGCTGTGATGGCTCCATTCTCATCGACGGCCCGAGCGCGGAGAAAGCGGCGCTGGCCAACCTCGGCCTCCGGGGCTTCGAAGTTATAGACGATGC
GAAGCGGCAGATCGAGGCAGCGTGTCCGGGAGTTGTCTCGTGCGCCGACATTCTTGCGCTCGCTGCCAGGGACGCGGTCTCAGAG
GTATCAAATCACAAACTTTCGATCGTCAGCTATTA
TAACAATCGTGGCTTGATCAATGACCTTAGAGTGGAGGACAGTTCTGGCCAGTTCCTCTGGGCCGACGGGACGGAAGAGTGTCCTCTGCCTCGGATGCATCAAACATGCCCTCGCCACTC
GACTCGGTCGCGGTGCTCAAGCAAAAGTTCTCGGCCAAAGGACTCACAACTCTGGATCTCGCAACTCTCAGTG
GTACGTGAAGTCACTCGAGCTTTCTCGATCAATCGACAAATCTGCCA
TACAGGTGCTCACACGATCGGCCAGACCGACTGCCGCTTTTTCAGCTACCGCCTCTACAACTTCTCGTCCACCGGCAAGCCGGATCCATCCATGAGCCAGAGCACTCTCGCTATGCTCCA
GCAGCAGTGTCCCAGGGGTGACGCGGGGCTCAACAAGGTGGCGCTCGACACGGGCAGCCAGGGCTCGTTCGACAGCAGCTACTTCCAGAACTTGCGGAATGGTGGCGGGGTGCTGGAGTC
GGACCAGCGCCTCATGGACGACACGGGGGCGCGCATCACGGTGACGGCGTTTGGGGTGGCCGGGGTGACGTTCCGGGCGGGGTTCGTGGCGTCCATGCTCCGGATGAGCGACATACAGGT
GCTCACTGGGAGCGATGGAGAGATTAGAAGAGCTTGCAATGCAGTGAATTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCTCACGGTTTTGGCGTTGCTCATAGTCGCGGCGGCTTACAATCTTGCAGAAGGTGCGACGAGGATTGGATTCTACGACGGCTCGTGCCCTCGAGTGGAAGCCATCGTTAAGTCC
ACAGTGAGATCACACATGAGCTCCAATCCTATGATTGGAGCCGGCGTTCTTCGCTTGCATTTCCACGACTGCTTTGTCCGA
GGCTGTGATGGCTCCATTCTCATCGACGGCCCGAGCGCG
GAGAAAGCGGCGCTGGCCAACCTCGGCCTCCGGGGCTTCGAAGTTATAGACGATGCGAAGCGGCAGATCGAGGCAGCGTGTCCGGGAGTTGTCTCGTGCGCCGACATTCTTGCGCTCGCT
GCCAGGGACGCGGTCTCAGAG
AGTGGAGGACAGTTCTGGCCAGTTCCTCTGGGCCGACGGGACGGAAGAGTGTCCTCTGCCTCGGATGCATCAAACATGCCCTCGCCACTCGACTCGGTC
GCGGTGCTCAAGCAAAAGTTCTCGGCCAAAGGACTCACAACTCTGGATCTCGCAACTCTCAGTG
GTGCTCACACGATCGGCCAGACCGACTGCCGCTTTTTCAGCTACCGCCTCTACAAC
TTCTCGTCCACCGGCAAGCCGGATCCATCCATGAGCCAGAGCACTCTCGCTATGCTCCAGCAGCAGTGTCCCAGGGGTGACGCGGGGCTCAACAAGGTGGCGCTCGACACGGGCAGCCAG
GGCTCGTTCGACAGCAGCTACTTCCAGAACTTGCGGAATGGTGGCGGGGTGCTGGAGTCGGACCAGCGCCTCATGGACGACACGGGGGCGCGCATCACGGTGACGGCGTTTGGGGTGGCC
GGGGTGACGTTCCGGGCGGGGTTCGTGGCGTCCATGCTCCGGATGAGCGACATACAGGTGCTCACTGGGAGCGATGGAGAGATTAGAAGAGCTTGCAATGCAGTGAATTGA

Retrieve as FASTA