Entry information : SmPrx98-2_9 (SmPrx98b_9)
Entry ID 7091
Creation 2009-10-22 (Paula Nunes)
Last sequence changes 2009-10-22 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx98-2_9 (SmPrx98b_9)
Name (synonym) SmPrx98-2_9 (SmPrx98b_9)
Class Class III peroxidase    [Orthogroup: Prx073]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx98-2_9
start..stop
S start..stop
SmPrx98-1_50 590 0 1..314 1..314
SmPrx99-1_50 583 0 1..314 1..314
SmPrx102-1_50 581 0 1..314 1..314
SmPrx101-1_50 565 0 1..314 1..314
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 237240..237488 249 N° 2 237037..237195 159 N° 3 236445..236981 537  
complement(join(236445..236981,237037..237195,237240..237488))


exon

Literature and cross-references SmPrx98-2_9 (SmPrx98b_9)
DNA ref. Phytozome 12:   scaffold_9 (237488..236445)
mRNA ref. JGI transcript:   88307 [Incorrect prediction]
Protein sequence: SmPrx98-2_9 (SmPrx98b_9)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   314 (286)
PWM (Da):   %s   33968.51 (30769.6)  
PI (pH):   %s   9.65 (8.50) Peptide Signal:   %s   cut: 29 range:29-314
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQRSKFQAPVVSAALLLVLALLRRYAFRQGSPTMSLELSTSFYANTCPDLPQIVRSVIRSEFSNDSRSAASILKLHFRDCFSRGCDGSLLLQRGDGRSAKGLKTINNVKRAVETSCPATVSCADILALSARESVIALGGPSWTVEFGRRDSPATVAAAMEAIPSPNLTATQLIERFQRRGLSKRDLVALAGGHSIGQAKCFTFSARLFNGTPGDSIDRAFKSRLEKNCPPTAPDRLTNLDPSPTTFDNLYFRALLANQSLLFSDQQLLEIDLVGFVKEFAANQQTFFTAFADGMIKMGNLSPITAGHGEIRSSC*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2). No EST. Short PS.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCGATCCAAATTCCAGGCTCCAGTCGTCTCTGCAGCATTACTGCTGGTGCTAGCACTGCTGCGGCGCTATGCATTTCGCCAGGGATCGCCAACAATGTCATTGGAGCTCTCAACT
TCTTTCTATGCTAACACTTGTCCCGATCTCCCTCAGATCGTGAGAAGTGTGATTCGCTCTGAATTTTCCAACGACAGTCGATCTGCTGCGTCGATCCTCAAGCTCCACTTCCGAGATTGC
TTCTCTCGA
GTAAGTCAGAAATTAAAATAGCGTTACTCATTTATGGCTGCCAGGGCTGCGACGGATCGCTGCTCCTCCAGCGAGGAGATGGGCGCTCCGCCAAGGGACTCAAAACCATCA
ACAACGTCAAGCGCGCCGTGGAGACTTCATGCCCGGCAACAGTATCGTGCGCGGACATTCTTGCGCTGAGCGCCCGGGAATCCGTCATAGCC
GTGAGTGAGAATCTCCATCGCGGCTTGA
GTTGATCATTCTCTTTCGACTTTGCAGCTGGGCGGCCCTTCATGGACAGTAGAATTTGGCCGACGGGACAGTCCCGCGACCGTCGCCGCCGCAATGGAGGCCATTCCCAGCCCAAACCTC
ACCGCAACGCAGCTCATCGAGCGCTTCCAAAGGCGGGGTCTTTCCAAGCGTGATCTCGTAGCACTTGCAGGAGGCCATTCCATCGGCCAGGCCAAGTGCTTTACATTTAGCGCACGCCTC
TTCAATGGAACCCCAGGAGATAGCATCGATCGGGCCTTCAAATCTCGACTCGAGAAGAATTGCCCTCCAACAGCCCCAGACAGATTGACCAATTTGGATCCATCCCCCACCACCTTCGAC
AACTTGTACTTTCGAGCTCTCCTGGCCAATCAGTCGCTCCTCTTTTCAGACCAGCAGCTCTTGGAGATTGATCTGGTGGGCTTTGTCAAGGAGTTTGCGGCCAACCAGCAGACATTCTTT
ACCGCCTTCGCTGATGGCATGATCAAAATGGGCAACCTCTCGCCAATCACAGCAGGGCATGGTGAAATTCGATCCTCGTGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCGATCCAAATTCCAGGCTCCAGTCGTCTCTGCAGCATTACTGCTGGTGCTAGCACTGCTGCGGCGCTATGCATTTCGCCAGGGATCGCCAACAATGTCATTGGAGCTCTCAACT
TCTTTCTATGCTAACACTTGTCCCGATCTCCCTCAGATCGTGAGAAGTGTGATTCGCTCTGAATTTTCCAACGACAGTCGATCTGCTGCGTCGATCCTCAAGCTCCACTTCCGAGATTGC
TTCTCTCGA
GGCTGCGACGGATCGCTGCTCCTCCAGCGAGGAGATGGGCGCTCCGCCAAGGGACTCAAAACCATCAACAACGTCAAGCGCGCCGTGGAGACTTCATGCCCGGCAACAGTA
TCGTGCGCGGACATTCTTGCGCTGAGCGCCCGGGAATCCGTCATAGCC
CTGGGCGGCCCTTCATGGACAGTAGAATTTGGCCGACGGGACAGTCCCGCGACCGTCGCCGCCGCAATGGAG
GCCATTCCCAGCCCAAACCTCACCGCAACGCAGCTCATCGAGCGCTTCCAAAGGCGGGGTCTTTCCAAGCGTGATCTCGTAGCACTTGCAGGAGGCCATTCCATCGGCCAGGCCAAGTGC
TTTACATTTAGCGCACGCCTCTTCAATGGAACCCCAGGAGATAGCATCGATCGGGCCTTCAAATCTCGACTCGAGAAGAATTGCCCTCCAACAGCCCCAGACAGATTGACCAATTTGGAT
CCATCCCCCACCACCTTCGACAACTTGTACTTTCGAGCTCTCCTGGCCAATCAGTCGCTCCTCTTTTCAGACCAGCAGCTCTTGGAGATTGATCTGGTGGGCTTTGTCAAGGAGTTTGCG
GCCAACCAGCAGACATTCTTTACCGCCTTCGCTGATGGCATGATCAAAATGGGCAACCTCTCGCCAATCACAGCAGGGCATGGTGAAATTCGATCCTCGTGCTAG

Retrieve as FASTA