Entry information : SmPrx97-2_9 (SmPrx97b_9)
Entry ID 7092
Creation 2009-10-22 (Paula Nunes)
Last sequence changes 2009-10-22 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx97-2_9 (SmPrx97b_9)
Name (synonym) SmPrx97-2_9 (SmPrx97b_9)
Class Class III peroxidase    [Orthogroup: Prx292]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx97-2_9
start..stop
S start..stop
SmPrx97-1_50 672 0 1..326 1..326
SmPrx36-2_44 348 7e-120 3..323 56..375
SmPrx36-1_2 348 8e-120 3..323 56..375
SmPrx50-2_101 342 4e-118 1..323 1..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 387061..387261 201 N° 2 386798..386989 192 N° 3 386150..386737 588  
complement(join(386150..386737,386798..386989,387061..387261))


exon

Literature and cross-references SmPrx97-2_9 (SmPrx97b_9)
DNA ref. Phytozome 12:   scaffold_9 (387261..386150)
mRNA ref. JGI transcript:   88102
Protein sequence: SmPrx97-2_9 (SmPrx97b_9)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   842 (307)
PWM (Da):   %s   97467.86 (33745.7)  
PI (pH):   %s   7.9 (4.86) Peptide Signal:   %s   cut: 20 range:20-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDRAFFLVLILAVIDWSLEEHLTPDFYQDSCPNLETTVRETVNKFVQDEPGIAASLLRLHFHDCFVTGCDASILLDDVPPRLGEKSAPPNSNFFRAYEVIDDVKFQLEQICDGVVSCADLLALAAREAVIASHGPHWKVHYGRRDTTVASLAAAAQDIPFANATTQELITRFENKGLSVEEMVALSGAHTIGQTRCAVVKDRLYDFMGTGQPDPALDKDLLQSLRESCPDTPSSDENFSPLDSQTPLRFDNAYFTDLRSGRGVLRSDQVLYSTPGATKSAVHLYSGDSSQFFEDFGRAMIKLGGLTPLTGKEGEIRRSCRFPNRWI*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCGAGCATTCTTCCTCGTTTTGATCCTGGCAGTGATTGATTGGAGCCTGGAAGAGCACCTCACTCCGGATTTCTACCAGGATTCCTGTCCCAATCTCGAGACCACAGTGCGAGAG
ACCGTAAATAAGTTCGTCCAGGACGAGCCGGGGATCGCAGCTTCACTCCTTCGCCTACATTTTCACGACTGCTTTGTCACG
GTAAAGTTCGAAGGGAAATCTCACTAGTACCTTGAGTTG
ATCGAAAAGATGGAGCATAACTTCTTTTGCAGGGCTGCGATGCTTCAATCCTCCTGGACGACGTTCCTCCCAGGCTGGGCGAGAAGAGCGCTCCTCCAAACTCAAACTTTTTTCGAGCTT
ACGAAGTCATCGACGACGTGAAGTTCCAACTGGAGCAAATCTGCGACGGCGTGGTTTCCTGCGCTGATCTCTTGGCTCTAGCTGCAAGAGAAGCCGTCATAGCG
GTGAGCGAAAGGAAAA
TGCCGAGATCAAAGCTCTCACCACCATCTTTTCTTCTGTGATAGTCACACGGCCCTCACTGGAAAGTCCACTATGGCCGAAGAGACACCACGGTGGCGAGCTTGGCGGCCGCTGCGCAGG
ACATACCTTTCGCCAACGCCACCACCCAAGAGCTCATCACAAGGTTTGAGAACAAAGGCCTGTCCGTGGAAGAAATGGTAGCTCTCTCGGGAGCTCACACAATCGGCCAGACACGCTGCG
CGGTCGTCAAGGATCGCCTCTACGACTTCATGGGAACGGGGCAGCCGGATCCAGCGTTGGACAAGGATTTGCTCCAATCCCTCCGTGAATCCTGCCCGGACACGCCCTCAAGCGATGAGA
ATTTCTCCCCTCTCGACTCCCAGACCCCTCTCCGATTCGACAATGCCTACTTCACGGACCTGAGGAGCGGCCGCGGTGTCCTCCGCTCGGATCAAGTGCTCTACTCCACGCCTGGCGCCA
CCAAGAGCGCCGTCCATCTCTATAGCGGCGATTCAAGCCAGTTCTTCGAGGATTTCGGGAGAGCGATGATCAAGCTAGGCGGATTGACGCCGCTAACAGGGAAGGAGGGCGAAATCCGAC
GCTCCTGTCGATTCCCAAACCGGTGGATCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCGAGCATTCTTCCTCGTTTTGATCCTGGCAGTGATTGATTGGAGCCTGGAAGAGCACCTCACTCCGGATTTCTACCAGGATTCCTGTCCCAATCTCGAGACCACAGTGCGAGAG
ACCGTAAATAAGTTCGTCCAGGACGAGCCGGGGATCGCAGCTTCACTCCTTCGCCTACATTTTCACGACTGCTTTGTCACG
GGCTGCGATGCTTCAATCCTCCTGGACGACGTTCCTCCC
AGGCTGGGCGAGAAGAGCGCTCCTCCAAACTCAAACTTTTTTCGAGCTTACGAAGTCATCGACGACGTGAAGTTCCAACTGGAGCAAATCTGCGACGGCGTGGTTTCCTGCGCTGATCTC
TTGGCTCTAGCTGCAAGAGAAGCCGTCATAGCG
TCACACGGCCCTCACTGGAAAGTCCACTATGGCCGAAGAGACACCACGGTGGCGAGCTTGGCGGCCGCTGCGCAGGACATACCTTTC
GCCAACGCCACCACCCAAGAGCTCATCACAAGGTTTGAGAACAAAGGCCTGTCCGTGGAAGAAATGGTAGCTCTCTCGGGAGCTCACACAATCGGCCAGACACGCTGCGCGGTCGTCAAG
GATCGCCTCTACGACTTCATGGGAACGGGGCAGCCGGATCCAGCGTTGGACAAGGATTTGCTCCAATCCCTCCGTGAATCCTGCCCGGACACGCCCTCAAGCGATGAGAATTTCTCCCCT
CTCGACTCCCAGACCCCTCTCCGATTCGACAATGCCTACTTCACGGACCTGAGGAGCGGCCGCGGTGTCCTCCGCTCGGATCAAGTGCTCTACTCCACGCCTGGCGCCACCAAGAGCGCC
GTCCATCTCTATAGCGGCGATTCAAGCCAGTTCTTCGAGGATTTCGGGAGAGCGATGATCAAGCTAGGCGGATTGACGCCGCTAACAGGGAAGGAGGGCGAAATCCGACGCTCCTGTCGA
TTCCCAAACCGGTGGATCTGA

Retrieve as FASTA