Entry information : SmPrx62-2_18 (SmPrx62b_18)
Entry ID 7094
Creation 2009-10-22 (Paula Nunes)
Last sequence changes 2009-10-22 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx62-2_18 (SmPrx62b_18)
Name (synonym) SmPrx62-2_18 (SmPrx62b_18)
Class Class III peroxidase    [Orthogroup: Prx287]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx62-2_18
start..stop
S start..stop
SmPrx62-1_19 663 0 1..326 1..326
SmPrx81-1_124 347 1e-119 5..326 4..330
SmPrx81-2_146 346 2e-119 5..326 4..330
PabPrx173 328 1e-112 30..326 22..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 499228..499455 228 N° 2 499521..499706 186 N° 3 499948..500113 166 N° 4 500352..500752 401
join(499228..499455,499521..499706,499948..500113,500352..500752)


exon

Literature and cross-references SmPrx62-2_18 (SmPrx62b_18)
DNA ref. Phytozome 12:   scaffold_18 (499228..500752)
mRNA ref. JGI transcript:   231875 [Incorrect prediction]
Protein sequence: SmPrx62-2_18 (SmPrx62b_18)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (299)
PWM (Da):   %s   35010.28 (32135.7) Transmb domain:   %s   i5-27o
PI (pH):   %s   5 (4.68) Peptide Signal:   %s   cut: 28 range:28-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDHRPVLARVLMVAMVTIAAAPPLIHAQDRLSSDFYSASCPNVESIVTTTMNRLSSENNVVPIGMLRLFAHDCFVEGCDASILLTGASTERAATDNLDFPQNPFDAMDELKKTVEESCPGVVSCADILAMATRDAVTFSGGPSWTVLKGRLDGTISRESRVAGHLPGADFDVEELESNFGALGLSLEDMVVLSGAHTIGFSHCHQFTSRLYGSSGSDPSLSPSFVSTLQKQCPQFGGNPTTVQAFDISTPFAFDNLYYKHLLTDEGLLVSDSTLTTRNDTLRLVNLFANSQEAFFSAFARSMVRLGSVGVKTRSGGEIRRVCSRVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Incorrect prediction from JGI (short PS is missing). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCATCGGCCGGTGCTCGCGCGCGTGTTGATGGTGGCGATGGTGACCATCGCAGCGGCGCCGCCTCTGATCCACGCGCAGGATCGGCTCTCGAGCGATTTCTACTCCGCCAGCTGC
CCCAACGTCGAATCCATCGTCACCACCACCATGAACAGGCTCTCGTCGGAAAACAACGTCGTCCCCATCGGGATGCTCCGCCTCTTCGCGCACGATTGCTTCGTGGAG
GTGACTCCCGAT
CGATCAATACAAATTCGAATTTTTCTTTGATCGAGCTCTCTTCTTTTGCGCAGGGATGCGACGCCTCGATCCTTCTCACAGGCGCGTCAACGGAGAGAGCTGCGACGGACAACCTGGATT
TCCCCCAGAATCCCTTCGACGCCATGGACGAGCTCAAGAAAACAGTGGAGGAATCGTGCCCGGGAGTCGTCTCGTGTGCCGACATCCTCGCGATGGCCACCCGCGACGCGGTCACCTTT
G
TAAGTTCTATCTCCACCCAATCCATATCCTTGCGACGAGTTCTTCCACTCCTTTCTCTCCTATCTTCTCTCGGATCACCCCACACACATATGGATCACAAAAGCACACACGGATCGACTG
CCATGCATCCTCTGTCTGTGCTGTCGGTTGCTCCCGGATTTGGCGAGTTCGTTGCGTTGTTCGACTGGCACTCACCCGGACTGACGCTCGCAAAACTTGTTCTTTTGTTTCTTTCTTCAG

AGTGGCGGACCAAGCTGGACAGTCCTCAAAGGACGGCTCGACGGGACCATCTCACGCGAATCCCGCGTCGCCGGGCACTTGCCCGGCGCCGACTTCGACGTGGAGGAGCTCGAGTCCAAT
TTCGGCGCCCTGGGACTCTCTCTCGAGGACATGGTCGTCCTCTCAG
GTACTTAAATAGAAACAAGCCTTCCCCCCTGTTTGCTCTCGATCCAATCCTCTCGTGGGCGATCGCAATTTCGC
GAGAATTTTGCTCCTGCTGGAACCCAATACGATTCTCTAGCAGCCCACATTCGCGATTTCTCGCCATCGCGCGGCCGAGACATATGCCCGAGCAGGGCATTCCCTGTTTTCTTCGTTGCA
AATTCCCGCTGTTCTGGCATTGATCGTTTCTTTCTCGCGATCAGGGGCACACACGATTGGATTCTCTCACTGCCACCAATTCACCAGTCGCCTCTACGGCTCCTCCGGCAGCGATCCCTC
GCTCAGCCCCAGCTTCGTCAGCACCCTCCAGAAGCAATGCCCGCAATTCGGCGGCAATCCCACCACCGTCCAGGCGTTTGATATCAGCACCCCCTTCGCCTTCGACAACTTGTACTACAA
GCACCTCCTCACGGACGAGGGCCTCTTGGTCTCCGACTCGACGCTCACCACCAGGAACGACACGCTCCGCCTCGTCAATCTCTTTGCCAACAGCCAGGAAGCGTTCTTCTCTGCGTTTGC
GCGGTCGATGGTCCGGCTGGGATCCGTGGGTGTCAAGACGAGGTCGGGTGGCGAGATCAGGAGAGTTTGCTCCAGAGTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCATCGGCCGGTGCTCGCGCGCGTGTTGATGGTGGCGATGGTGACCATCGCAGCGGCGCCGCCTCTGATCCACGCGCAGGATCGGCTCTCGAGCGATTTCTACTCCGCCAGCTGC
CCCAACGTCGAATCCATCGTCACCACCACCATGAACAGGCTCTCGTCGGAAAACAACGTCGTCCCCATCGGGATGCTCCGCCTCTTCGCGCACGATTGCTTCGTGGAG
GGATGCGACGCC
TCGATCCTTCTCACAGGCGCGTCAACGGAGAGAGCTGCGACGGACAACCTGGATTTCCCCCAGAATCCCTTCGACGCCATGGACGAGCTCAAGAAAACAGTGGAGGAATCGTGCCCGGGA
GTCGTCTCGTGTGCCGACATCCTCGCGATGGCCACCCGCGACGCGGTCACCTTT
AGTGGCGGACCAAGCTGGACAGTCCTCAAAGGACGGCTCGACGGGACCATCTCACGCGAATCCCGC
GTCGCCGGGCACTTGCCCGGCGCCGACTTCGACGTGGAGGAGCTCGAGTCCAATTTCGGCGCCCTGGGACTCTCTCTCGAGGACATGGTCGTCCTCTCAG
GGGCACACACGATTGGATTC
TCTCACTGCCACCAATTCACCAGTCGCCTCTACGGCTCCTCCGGCAGCGATCCCTCGCTCAGCCCCAGCTTCGTCAGCACCCTCCAGAAGCAATGCCCGCAATTCGGCGGCAATCCCACC
ACCGTCCAGGCGTTTGATATCAGCACCCCCTTCGCCTTCGACAACTTGTACTACAAGCACCTCCTCACGGACGAGGGCCTCTTGGTCTCCGACTCGACGCTCACCACCAGGAACGACACG
CTCCGCCTCGTCAATCTCTTTGCCAACAGCCAGGAAGCGTTCTTCTCTGCGTTTGCGCGGTCGATGGTCCGGCTGGGATCCGTGGGTGTCAAGACGAGGTCGGGTGGCGAGATCAGGAGA
GTTTGCTCCAGAGTCAACTGA

Retrieve as FASTA