Entry information : SmPrx63-2_18 (SmPrx63b_18)
Entry ID 7095
Creation 2009-10-22 (Paula Nunes)
Last sequence changes 2009-10-22 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx63-2_18 (SmPrx63b_18)
Name (synonym) SmPrx63-2_18 (SmPrx63b_18)
Class Class III peroxidase    [Orthogroup: Prx073]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx63-2_18
start..stop
S start..stop
SmPrx64-2_18 644 0 1..320 40..359
SmPrx64-1_19 592 0 1..320 1..322
SmPrx63-1_19 555 0 1..320 1..308
SmPrx102-1_50 508 0 1..320 1..314
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 940564..940812 249 N° 2 940340..940510 171 N° 3 939737..940279 543  
complement(join(939737..940279,940340..940510,940564..940812))


exon

Literature and cross-references SmPrx63-2_18 (SmPrx63b_18)
DNA ref. Phytozome 12:   scaffold_18 (940812..939737)
mRNA ref. JGI transcript:   3741 [Incorrect prediction]
Protein sequence: SmPrx63-2_18 (SmPrx63b_18)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320 (302)
PWM (Da):   %s   34372.57 (32412.5)  
PI (pH):   %s   8.69 (8.49) Peptide Signal:   %s   cut: 30 range:19-320
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQQFKYLAPLTSAALLLALTLLRRYAIHQESPTTPSELSTSFYANTCPDFPQIARSVIRFEVANDSRSSASILKLHFRDCFAQGCDGSLLPQVGKERGDGRSTKGLKIINNIKRAVETSCPETVSCADILALSARESVIALGGPSWTVEFGRRDNPSSASVAAAVDAIPSPNLTATQLIESFQKRGLSKRDLVALSGGHSIGQAQCSTFSARLFNGTAGDSIDPALKSRLEKTCPPTALNRLNNLDPSPTTFDNLYFRAVQANQSLLFSDQQLLQSDLAGFVREFADNQKAFFTAFANGMIKMGRLSPLTGGHGEIRASC*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2). Incorrect prediction from JGI (short PS is missing). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCAATTTAAATATCTAGCTCCACTCACCTCAGCAGCATTACTCCTCGCGTTAACGCTGCTGCGGCGCTATGCAATTCACCAGGAATCACCAACAACGCCCTCGGAGCTCTCCACT
TCTTTCTACGCTAATACTTGCCCCGACTTCCCCCAGATCGCTAGAAGCGTGATTCGCTTTGAAGTTGCCAATGACAGCCGATCCTCTGCATCCATCCTCAAGCTCCACTTCCGCGATTGC
TTTGCTCAA
GTAAGTACTCTAATAATAAGTCCTCGTTTGTCATTTATTTGGCTGTCGCTCAGGGCTGTGACGGATCGCTGCTCCCCCAGGTCGGGAAGGAGCGAGGAGACGGACGCTCCA
CCAAGGGACTCAAAATCATCAACAATATCAAACGCGCCGTGGAGACTTCATGCCCGGAAACTGTATCATGCGCGGACATTCTTGCTCTGAGCGCCCGGGAATCCGTCATAGCC
GTAAGTG
AGGTCTCCATTGATTTGAGTTACAAATGCTTTCTTCTCTTTCGAAATTTGCAGCTTGGTGGCCCGTCATGGACAGTAGAGTTTGGCCGACGGGACAATCCCAGCTCCGCGAGCGTCGCTG
CCGCGGTGGACGCCATTCCCAGCCCAAATCTCACCGCAACGCAGCTGATTGAGAGCTTCCAAAAGCGGGGCCTTTCCAAGCGTGATCTCGTAGCGCTCTCAGGAGGCCATTCCATCGGCC
AGGCCCAGTGCTCCACATTCAGCGCCCGCCTCTTCAACGGAACCGCAGGGGATAGCATCGATCCGGCCCTCAAGTCCCGACTCGAGAAGACTTGCCCTCCAACAGCCCTAAACAGATTGA
ACAATTTGGATCCCTCCCCCACCACGTTCGACAACTTGTACTTTCGAGCTGTCCAAGCGAATCAGTCGCTCCTCTTCTCAGACCAGCAGCTGTTGCAGAGTGATCTGGCGGGCTTTGTCA
GGGAGTTTGCGGACAATCAGAAGGCATTTTTCACTGCCTTCGCCAATGGCATGATCAAAATGGGTAGGCTCTCGCCTCTCACGGGAGGACATGGTGAAATTCGAGCCTCGTGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCAATTTAAATATCTAGCTCCACTCACCTCAGCAGCATTACTCCTCGCGTTAACGCTGCTGCGGCGCTATGCAATTCACCAGGAATCACCAACAACGCCCTCGGAGCTCTCCACT
TCTTTCTACGCTAATACTTGCCCCGACTTCCCCCAGATCGCTAGAAGCGTGATTCGCTTTGAAGTTGCCAATGACAGCCGATCCTCTGCATCCATCCTCAAGCTCCACTTCCGCGATTGC
TTTGCTCAA
GGCTGTGACGGATCGCTGCTCCCCCAGGTCGGGAAGGAGCGAGGAGACGGACGCTCCACCAAGGGACTCAAAATCATCAACAATATCAAACGCGCCGTGGAGACTTCATGC
CCGGAAACTGTATCATGCGCGGACATTCTTGCTCTGAGCGCCCGGGAATCCGTCATAGCC
CTTGGTGGCCCGTCATGGACAGTAGAGTTTGGCCGACGGGACAATCCCAGCTCCGCGAGC
GTCGCTGCCGCGGTGGACGCCATTCCCAGCCCAAATCTCACCGCAACGCAGCTGATTGAGAGCTTCCAAAAGCGGGGCCTTTCCAAGCGTGATCTCGTAGCGCTCTCAGGAGGCCATTCC
ATCGGCCAGGCCCAGTGCTCCACATTCAGCGCCCGCCTCTTCAACGGAACCGCAGGGGATAGCATCGATCCGGCCCTCAAGTCCCGACTCGAGAAGACTTGCCCTCCAACAGCCCTAAAC
AGATTGAACAATTTGGATCCCTCCCCCACCACGTTCGACAACTTGTACTTTCGAGCTGTCCAAGCGAATCAGTCGCTCCTCTTCTCAGACCAGCAGCTGTTGCAGAGTGATCTGGCGGGC
TTTGTCAGGGAGTTTGCGGACAATCAGAAGGCATTTTTCACTGCCTTCGCCAATGGCATGATCAAAATGGGTAGGCTCTCGCCTCTCACGGGAGGACATGGTGAAATTCGAGCCTCGTGC
TAG

Retrieve as FASTA