Entry information : SmPrx64-2_18 (SmPrx64b_18)
Entry ID 7096
Creation 2009-10-22 (Paula Nunes)
Last sequence changes 2011-01-26 (Toky Ramarohetra)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-26 (Toky Ramarohetra)
Peroxidase information: SmPrx64-2_18 (SmPrx64b_18)
Name (synonym) SmPrx64-2_18 (SmPrx64b_18)
Class Class III peroxidase    [Orthogroup: Prx075]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx64-2_18
start..stop
S start..stop
SmPrx63-2_18 644 0 40..359 1..320
SmPrx64-1_19 593 0 40..359 1..322
SmPrx63-1_19 548 0 40..359 1..308
SmPrx102-1_50 506 0 40..359 1..314
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 941973..942338 366 N° 2 942392..942562 171 N° 3 942623..943165 543  
join(941973..942338,942392..942562,942623..943165)


exon

Literature and cross-references SmPrx64-2_18 (SmPrx64b_18)
DNA ref. Phytozome 12:   scaffold_18 (941973..943165)
mRNA ref. JGI transcript:   14687 [Incorrect prediction]
Protein sequence: SmPrx64-2_18 (SmPrx64b_18)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   359
PWM (Da):   %s   38788.15  
PI (pH):   %s   9.13
Sequence 400
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MCSIFLLFLESHPEKLVLVLGQEAKLLFTPSLPRERKITMQQFKYLAPLTSAALLLALTLLRRYAIHQESPTTPSELSTSFYANTCPNFPQIARSVIRFEVANDSRSSASILKLHFRDCFAQGCDGSLLPQVGKERGDGRSTKGLKIINNIKRAVETSCPETVSCADILALSARESVIALGGPSWTVEFGRRDNPSSASVAAAVDAIPSPNLTATQLIESFQKRGLSKRDLVALSGGHSIGQAQCSTFSARLFNGTAGDSIDPALKSRLEKTCPPTALNRLNNLDPSPTTFDNLYFRAVQANQSLLFSDQQLLQSDLAGFVKEFANNQKAFFTAFANAMIKIGKLSPLTGGHGEIRASC

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2). No EST. Incorrect prediction from JGI (short PS).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTGTTCTATTTTCTTGCTGTTTCTTGAAAGCCATCCAGAGAAGCTTGTTCTTGTTCTGGGCCAAGAGGCCAAGCTTCTCTTCACACCTTCACTCCCTCGTGAAAGAAAGATCACAATGC
AGCAATTTAAATATCTAGCTCCACTCACCTCAGCAGCATTACTCCTCGCGTTAACGCTGCTGCGGCGCTATGCAATTCACCAGGAATCACCAACAACGCCCTCGGAGCTCTCCACTTCTT
TCTACGCTAATACTTGTCCCAACTTCCCCCAGATCGCTAGAAGCGTGATTCGCTTTGAAGTTGCCAATGACAGCCGATCCTCTGCATCCATCCTCAAGCTCCACTTCCGCGATTGCTTTG
CTCAA
GTAAGTACTCTAATAATAAGTCCTCGTTTGTCATTTATTTGGCTGTCGCTCAGGGCTGTGACGGATCGCTGCTCCCCCAGGTCGGGAAGGAGCGAGGAGACGGACGCTCCACCAA
GGGACTCAAAATCATCAACAATATCAAACGCGCCGTGGAGACCTCATGCCCGGAAACTGTATCATGCGCGGACATTCTTGCTCTGAGCGCCCGGGAATCCGTCATAGCC
GTAAGTGAGGT
CTCCATTGATTTGAGTTACAAATGCTTTCTTCTCTTTCGAAATTTGCAGCTTGGTGGCCCGTCATGGACAGTAGAGTTTGGCCGACGGGACAATCCCAGCTCCGCGAGCGTCGCTGCCGC
GGTGGACGCCATTCCCAGCCCAAATCTCACCGCAACGCAGCTGATTGAGAGCTTCCAAAAGCGGGGCCTTTCCAAGCGTGATCTCGTAGCGCTCTCAGGAGGCCATTCCATCGGCCAGGC
CCAGTGCTCCACATTTAGCGCCCGCCTCTTCAACGGAACCGCAGGGGATAGCATCGATCCGGCCCTCAAGTCCCGACTCGAGAAGACTTGCCCTCCAACAGCCCTAAACAGATTGAACAA
TTTGGATCCCTCCCCCACCACGTTCGACAACTTATACTTTCGAGCCGTCCAAGCGAATCAGTCACTCCTCTTCTCAGACCAGCAGCTCTTGCAGAGTGATCTGGCGGGCTTTGTCAAGGA
GTTTGCGAACAACCAGAAGGCATTTTTTACCGCCTTCGCCAATGCCATGATCAAAATTGGTAAGCTCTCGCCTCTCACGGGAGGACATGGTGAAATTCGAGCGTCGTGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
TGTGTTCTATTTTCTTGCTGTTTCTTGAAAGCCATCCAGAGAAGCTTGTTCTTGTTCTGGGCCAAGAGGCCAAGCTTCTCTTCACACCTTCACTCCCTCGTGAAAGAAAGATCACAATGC
AGCAATTTAAATATCTAGCTCCACTCACCTCAGCAGCATTACTCCTCGCGTTAACGCTGCTGCGGCGCTATGCAATTCACCAGGAATCACCAACAACGCCCTCGGAGCTCTCCACTTCTT
TCTACGCTAATACTTGTCCCAACTTCCCCCAGATCGCTAGAAGCGTGATTCGCTTTGAAGTTGCCAATGACAGCCGATCCTCTGCATCCATCCTCAAGCTCCACTTCCGCGATTGCTTTG
CTCAA
GGCTGTGACGGATCGCTGCTCCCCCAGGTCGGGAAGGAGCGAGGAGACGGACGCTCCACCAAGGGACTCAAAATCATCAACAATATCAAACGCGCCGTGGAGACCTCATGCCCGG
AAACTGTATCATGCGCGGACATTCTTGCTCTGAGCGCCCGGGAATCCGTCATAGCC
CTTGGTGGCCCGTCATGGACAGTAGAGTTTGGCCGACGGGACAATCCCAGCTCCGCGAGCGTCG
CTGCCGCGGTGGACGCCATTCCCAGCCCAAATCTCACCGCAACGCAGCTGATTGAGAGCTTCCAAAAGCGGGGCCTTTCCAAGCGTGATCTCGTAGCGCTCTCAGGAGGCCATTCCATCG
GCCAGGCCCAGTGCTCCACATTTAGCGCCCGCCTCTTCAACGGAACCGCAGGGGATAGCATCGATCCGGCCCTCAAGTCCCGACTCGAGAAGACTTGCCCTCCAACAGCCCTAAACAGAT
TGAACAATTTGGATCCCTCCCCCACCACGTTCGACAACTTATACTTTCGAGCCGTCCAAGCGAATCAGTCACTCCTCTTCTCAGACCAGCAGCTCTTGCAGAGTGATCTGGCGGGCTTTG
TCAAGGAGTTTGCGAACAACCAGAAGGCATTTTTTACCGCCTTCGCCAATGCCATGATCAAAATTGGTAAGCTCTCGCCTCTCACGGGAGGACATGGTGAAATTCGAGCGTCGTGCTAG

Retrieve as FASTA