Entry information : SmPrx62-1_19 (SmPrx62a_19)
Entry ID 7098
Creation 2009-10-22 (Paula Nunes)
Last sequence changes 2009-10-22 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx62-1_19 (SmPrx62a_19)
Name (synonym) SmPrx62-1_19 (SmPrx62a_19)
Class Class III peroxidase    [Orthogroup: Prx287]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx62-1_19
start..stop
S start..stop
SmPrx62-2_18 663 0 1..326 1..326
SmPrx81-1_124 350 6e-121 5..326 4..330
SmPrx81-2_146 349 1e-120 5..326 4..330
PabPrx173 328 1e-112 30..326 22..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1899490..1899717 228 N° 2 1899783..1899968 186 N° 3 1900219..1900384 166 N° 4 1900623..1901023 401
join(1899490..1899717,1899783..1899968,1900219..1900384,1900623..1901023)


exon

Literature and cross-references SmPrx62-1_19 (SmPrx62a_19)
DNA ref. Phytozome 12:   scaffold_19 (1899490..1901023)
mRNA ref. JGI transcript:   97355 [Incorrect prediction]
Protein sequence: SmPrx62-1_19 (SmPrx62a_19)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (299)
PWM (Da):   %s   34980.27 (32105.7) Transmb domain:   %s   i5-27o
PI (pH):   %s   5 (4.68) Peptide Signal:   %s   cut: 28 range:28-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDHRPVLARVLMVAMVTIAAAPPLIHAQDRLSRDFYSASCPNVESIVTTTMNRLSSENNVVPIGMLRLFAHDCFVEGCDASILLTGASTERAATDNLDFPQNPFDAMDELKKTVEESCPGVVSCADILAMATRDAVTFSGGPSWTVLKGRLDGTISRESRVAGHLPGADFDVEELESNFGALGLSLEDMVVLSGAHTIGFSHCHQFTSRLYGSSGSDPSLSPSFVSTLQKQCPQFGGNPTTVQAFDISTPFAFDNLYYKHLLTDEGLLVSDSTLTTRNDTLRLVNLFANSQEAFFSAFARSMVRLGSVGVKTGSGGEIRRVCSRVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Incorrect prediction from JGI (short PS is missing). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCATCGGCCGGTGCTCGCGCGCGTGTTGATGGTGGCGATGGTGACCATCGCAGCGGCGCCGCCTCTGATCCACGCGCAGGATCGGCTCTCGAGAGATTTCTACTCCGCCAGCTGC
CCCAACGTGGAATCCATCGTCACCACCACCATGAACAGGCTCTCGTCGGAAAACAACGTCGTCCCCATCGGGATGCTCCGCCTCTTCGCGCACGATTGCTTCGTGGAG
GTGACTCCCGAT
CGATCAATACAAATTCGAATTTTTCTTTGATCGAGCTCTCTTCTTTTGCGCAGGGATGCGACGCCTCGATCCTTCTCACAGGCGCGTCAACGGAGAGAGCTGCGACGGACAACCTGGATT
TCCCCCAGAATCCCTTCGACGCCATGGACGAGCTCAAGAAAACAGTGGAGGAATCGTGCCCGGGAGTCGTCTCGTGTGCCGACATCCTCGCGATGGCCACCCGCGACGCGGTCACCTTT
G
TAAGTTTTCCACAATCTATCTCCATCCAATCCATATCCTTGCGAGGAGTTCTTCCACTCCTTTCTCTCCTATCTTCTCTCGGATCACCCCACACACATATGGATCACAAAAGCACACACG
GATCGACTGCCATGCATCCTCTGTCTGTGCTGTCGGTTGCTCCCGGATTTGGCGAGTTCGTTGCGTTGTTCGACTGGCACTCACCCGGACTGACGCTCGCAAAACTTGTTCTTTTGTTTC
TTTCTTCAGAGTGGCGGACCAAGCTGGACAGTCCTCAAGGGACGGCTCGACGGGACCATCTCACGCGAATCCCGCGTCGCCGGGCACTTGCCCGGCGCCGACTTCGACGTGGAGGAGCTC
GAGTCCAATTTCGGCGCCCTGGGACTCTCTCTCGAGGACATGGTCGTCCTCTCAG
GTACTTAAATAGAAACAAGCCCTCCCCCCTGTTTGCTCTCGATCCAATCCTCTCGTGGGCGATCG
CAATTTCGCGAGAATTTTGCTCCTGCTGGAACCCAATACGATTCTCTAGCACCCCACATTCGCGATTTCTCGCCATCGCGCGGCCGAGACATATGCCCGAGCAGGGCATTCCCTGTTTTC
TTCGTTGCAAATTCCCGCTGTTCTGGCATTGATCGTTTCTTTCTCGCGATCAGGGGCACACACGATTGGATTCTCTCACTGCCACCAATTCACCAGTCGCCTCTACGGCTCCTCCGGCAG
CGATCCCTCGCTCAGCCCCAGCTTCGTCAGCACCCTCCAGAAGCAATGCCCGCAATTCGGCGGCAATCCCACCACCGTCCAGGCGTTTGATATCAGCACCCCCTTCGCCTTCGACAACTT
GTACTACAAGCACCTCCTCACGGACGAGGGCCTCTTGGTCTCCGACTCGACGCTCACCACCAGGAACGACACGCTCCGCCTCGTCAATCTCTTTGCCAACAGCCAGGAAGCGTTCTTCTC
TGCGTTTGCGCGGTCGATGGTCCGGCTGGGATCCGTGGGTGTCAAGACGGGGTCGGGTGGCGAGATCAGGAGAGTTTGCTCCAGAGTCAACTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCATCGGCCGGTGCTCGCGCGCGTGTTGATGGTGGCGATGGTGACCATCGCAGCGGCGCCGCCTCTGATCCACGCGCAGGATCGGCTCTCGAGAGATTTCTACTCCGCCAGCTGC
CCCAACGTGGAATCCATCGTCACCACCACCATGAACAGGCTCTCGTCGGAAAACAACGTCGTCCCCATCGGGATGCTCCGCCTCTTCGCGCACGATTGCTTCGTGGAG
GGATGCGACGCC
TCGATCCTTCTCACAGGCGCGTCAACGGAGAGAGCTGCGACGGACAACCTGGATTTCCCCCAGAATCCCTTCGACGCCATGGACGAGCTCAAGAAAACAGTGGAGGAATCGTGCCCGGGA
GTCGTCTCGTGTGCCGACATCCTCGCGATGGCCACCCGCGACGCGGTCACCTTT
AGTGGCGGACCAAGCTGGACAGTCCTCAAGGGACGGCTCGACGGGACCATCTCACGCGAATCCCGC
GTCGCCGGGCACTTGCCCGGCGCCGACTTCGACGTGGAGGAGCTCGAGTCCAATTTCGGCGCCCTGGGACTCTCTCTCGAGGACATGGTCGTCCTCTCAG
GGGCACACACGATTGGATTC
TCTCACTGCCACCAATTCACCAGTCGCCTCTACGGCTCCTCCGGCAGCGATCCCTCGCTCAGCCCCAGCTTCGTCAGCACCCTCCAGAAGCAATGCCCGCAATTCGGCGGCAATCCCACC
ACCGTCCAGGCGTTTGATATCAGCACCCCCTTCGCCTTCGACAACTTGTACTACAAGCACCTCCTCACGGACGAGGGCCTCTTGGTCTCCGACTCGACGCTCACCACCAGGAACGACACG
CTCCGCCTCGTCAATCTCTTTGCCAACAGCCAGGAAGCGTTCTTCTCTGCGTTTGCGCGGTCGATGGTCCGGCTGGGATCCGTGGGTGTCAAGACGGGGTCGGGTGGCGAGATCAGGAGA
GTTTGCTCCAGAGTCAACTGA

Retrieve as FASTA