Entry information : SmPrx64-1_19 (SmPrx64a_19)
Entry ID 7100
Creation 2009-10-22 (Paula Nunes)
Last sequence changes 2009-10-22 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx64-1_19 (SmPrx64a_19)
Name (synonym) SmPrx64-1_19 (SmPrx64a_19)
Class Class III peroxidase    [Orthogroup: Prx073]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx64-1_19
start..stop
S start..stop
SmPrx64-2_18 571 0 25..322 62..359
SmPrx63-2_18 569 0 25..322 23..320
SmPrx63-1_19 554 0 29..322 19..308
SmPrx102-1_50 499 2e-180 1..322 1..314
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2226176..2226430 255 N° 2 2226481..2226651 171 N° 3 2226701..2227243 543  
join(2226176..2226430,2226481..2226651,2226701..2227243)


exon

Literature and cross-references SmPrx64-1_19 (SmPrx64a_19)
DNA ref. Phytozome 12:   scaffold_19 (2226176..2227243)
mRNA ref. JGI transcript:   3754 [Incorrect prediction]
Protein sequence: SmPrx64-1_19 (SmPrx64a_19)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322
PWM (Da):   %s   34479.85 Transmb domain:   %s   i7-29o
PI (pH):   %s   8.89
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQRVKFLTPLTSAALLLVLLLTLLRHYAIHKESPTTPSELSTSFYANTCPDFPKIARSVIRSEVANDSRSSASILKLHFRDCFAQGCDGSLLPQVGKEQGDGRSTKGLKIINNIKRAVETSCPETVSCADILALSARESVIALGGPSWTVEFGRRDNPSSTSVAAAVDAIPSPNLTATQLIESFQKRGLSKRDLVALSGGHSIGQAQCSTFSARLFNGTAGDSIDPALKSRLEKTCPPTAPNRLNNLDPSPTTFDNLYFRAVQANQSLLFSDQQLLQSDLAGFVKEFADNQKAFFIAFANAMIKIGKLSPLTGGHGEIRASC*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2). No EST. Incorrect prediction from JGI (short PS).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCGAGTCAAATTTCTAACTCCACTCACCTCGGCAGCGTTACTGCTCGTGTTACTGTTAACGTTGCTACGGCACTATGCAATTCACAAGGAATCACCAACGACGCCCTCGGAGCTC
TCCACTTCTTTCTATGCTAATACTTGTCCCGACTTCCCCAAGATCGCTAGAAGCGTGATTCGCTCTGAAGTTGCCAATGACAGCCGATCCTCTGCATCCATCCTCAAGCTCCACTTCCGT
GATTGCTTTGCTCAA
GTAAGTACTCCAATAAGTCCCCGTTACTCATTTATTTGGCTGTCGCTCAGGGCTGTGACGGATCGCTGCTCCCCCAGGTCGGGAAGGAGCAAGGAGATGGACGCT
CCACCAAGGGACTCAAAATCATCAACAATATCAAGCGCGCCGTGGAGACTTCATGCCCGGAAACTGTATCATGCGCCGACATTCTTGCTCTGAGCGCCCGGGAATCCGTCATAGCC
GTAA
GTGAGGTCTCCATTGATTTGAGTTACAAATGCTTTCTTCTTGCAGCTTGGTGGCCCGTCATGGACAGTTGAATTTGGTCGACGGGACAATCCCAGCTCCACGAGCGTCGCTGCCGCGGTG
GACGCCATTCCCAGCCCAAATCTCACCGCAACGCAGCTGATTGAGAGCTTCCAAAAGCGGGGCCTTTCCAAGCGTGATCTCGTAGCGCTCTCGGGAGGCCATTCCATCGGCCAGGCCCAG
TGCTCCACATTCAGCGCCCGCCTCTTCAACGGAACCGCAGGGGATAGCATCGATCCGGCCCTCAAGTCCCGACTCGAGAAGACTTGCCCTCCAACAGCCCCAAACAGATTGAACAATTTG
GATCCCTCCCCCACCACGTTCGACAACTTGTACTTTCGAGCTGTCCAAGCCAATCAGTCGCTCCTCTTCTCAGACCAGCAGCTGTTGCAGAGTGACCTGGCGGGCTTTGTCAAGGAGTTT
GCGGACAACCAGAAGGCATTTTTTATCGCCTTCGCCAATGCCATGATCAAAATTGGTAAGCTCTCGCCTCTCACGGGAGGACATGGTGAAATTCGAGCCTCGTGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCGAGTCAAATTTCTAACTCCACTCACCTCGGCAGCGTTACTGCTCGTGTTACTGTTAACGTTGCTACGGCACTATGCAATTCACAAGGAATCACCAACGACGCCCTCGGAGCTC
TCCACTTCTTTCTATGCTAATACTTGTCCCGACTTCCCCAAGATCGCTAGAAGCGTGATTCGCTCTGAAGTTGCCAATGACAGCCGATCCTCTGCATCCATCCTCAAGCTCCACTTCCGT
GATTGCTTTGCTCAA
GGCTGTGACGGATCGCTGCTCCCCCAGGTCGGGAAGGAGCAAGGAGATGGACGCTCCACCAAGGGACTCAAAATCATCAACAATATCAAGCGCGCCGTGGAGACT
TCATGCCCGGAAACTGTATCATGCGCCGACATTCTTGCTCTGAGCGCCCGGGAATCCGTCATAGCC
CTTGGTGGCCCGTCATGGACAGTTGAATTTGGTCGACGGGACAATCCCAGCTCC
ACGAGCGTCGCTGCCGCGGTGGACGCCATTCCCAGCCCAAATCTCACCGCAACGCAGCTGATTGAGAGCTTCCAAAAGCGGGGCCTTTCCAAGCGTGATCTCGTAGCGCTCTCGGGAGGC
CATTCCATCGGCCAGGCCCAGTGCTCCACATTCAGCGCCCGCCTCTTCAACGGAACCGCAGGGGATAGCATCGATCCGGCCCTCAAGTCCCGACTCGAGAAGACTTGCCCTCCAACAGCC
CCAAACAGATTGAACAATTTGGATCCCTCCCCCACCACGTTCGACAACTTGTACTTTCGAGCTGTCCAAGCCAATCAGTCGCTCCTCTTCTCAGACCAGCAGCTGTTGCAGAGTGACCTG
GCGGGCTTTGTCAAGGAGTTTGCGGACAACCAGAAGGCATTTTTTATCGCCTTCGCCAATGCCATGATCAAAATTGGTAAGCTCTCGCCTCTCACGGGAGGACATGGTGAAATTCGAGCC
TCGTGCTAG

Retrieve as FASTA