Entry information : SmPrx87-1_24 (SmPrx87a_24)
Entry ID 7101
Creation 2009-10-30 (Christophe Dunand)
Last sequence changes 2009-10-30 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-09-04 (Qiang Li)
Peroxidase information: SmPrx87-1_24 (SmPrx87a_24)
Name (synonym) SmPrx87-1_24 (SmPrx87a_24)
Class Class III peroxidase    [Orthogroup: Prx077]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx87-1_24
start..stop
S start..stop
SmPrx87-2_26 648 0 1..320 1..320
SmPrx88-1_24 427 1e-151 9..320 9..320
SmPrx88-2_26 424 1e-150 9..320 9..321
SmPrx58-1_129 420 4e-149 12..320 3..315
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 287633..287845 213 N° 2 287364..287546 183 N° 3 286702..287268 567  
complement(join(286702..287268,287364..287546,287633..287845))


exon

Literature and cross-references SmPrx87-1_24 (SmPrx87a_24)
DNA ref. Phytozome 12:   scaffold_24 (287845..286702)
mRNA ref. JGI transcript:   101253 [Incorrect prediction]
Protein sequence: SmPrx87-1_24 (SmPrx87a_24)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320 (296)
PWM (Da):   %s   33781.66 (31242.4)  
PI (pH):   %s   8.65 (8.58) Peptide Signal:   %s   cut: 25 range:25-320
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAYSRAAAWSCLIAVMLLGFQANAQLSSSFYSSTCPNLISIVRTAISNAVNRENRMAASILRLHFHDCFVNGCDASILLDGSSGEKNAGPNVNSARGFDVIDNVKAAVESSCKGVVSCADILALSAREAVVALRGPSWTVVFGRRDSTTSSQSTANSAIPPPSSTASRLITSFQNQGLSTQDLVALSGSHTIGQAQCTNFRARLYNGTSGDTIDASFKSNLERNCPSTGGNSNLAPLDLQTPVTFDNLYFKNLQAQKGLLFSDQQLFSGGQSSLMSTVNTYANNQQAFFSAFATAMVKMGNINPLTGSNGQIRANCRKTN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2). Incorrect transcript prediction from JGI (fusion of two exon 1 from one ORF with exons 2,3,4 from a second ORF).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTATAGTCGAGCGGCAGCGTGGTCGTGTTTGATTGCTGTGATGCTGCTAGGATTCCAAGCCAATGCTCAGCTCAGCTCTTCCTTTTACTCGAGCACCTGTCCCAACCTCATTTCC
ATTGTCCGAACCGCCATCAGCAATGCTGTCAACAGAGAGAACAGGATGGCGGCATCCATTCTCCGTCTCCACTTTCACGATTGCTTTGTAAAC
GTAAGCTGGAGTTTCTGAGATCCCAAG
TTGCATTTCAAAGTTGTCGCCTGACTTGTTTCTCCTTTTCTTTCCTCTGTCTCTTGTAGGGCTGTGATGCATCGATTCTTTTGGATGGATCCAGTGGAGAAAAGAACGCAGGGCCAAACG
TGAACTCTGCCCGAGGCTTTGATGTCATTGACAATGTCAAGGCCGCGGTGGAGAGCTCCTGCAAAGGCGTTGTTTCGTGTGCCGACATTCTCGCACTCAGCGCGAGGGAAGCCGTTGTTG
CG
GTAACGATTTCTATCCTATCCTTACCTCGTCTGATACTTCGTTCCTCCGAAGCTACCCTAAACCAGAGCATTTTGAAAACTTTCTGATGGTGCAGCTTAGAGGACCGTCTTGGACTGT
TGTCTTTGGGCGACGAGATAGCACAACTTCGAGCCAGAGCACTGCAAACTCGGCAATCCCCCCACCATCGTCCACTGCCTCGAGGCTCATTACCAGCTTCCAGAACCAAGGCCTCTCAAC
TCAAGATCTCGTAGCGCTGTCTGGCAGTCACACCATCGGCCAGGCCCAGTGCACCAACTTCCGGGCTCGCCTGTACAATGGCACTTCAGGTGACACCATTGACGCATCATTCAAATCGAA
CCTGGAGAGGAACTGCCCGAGCACCGGAGGGAACTCGAATCTTGCGCCTCTGGATCTTCAGACTCCGGTCACCTTCGACAACCTCTACTTCAAGAATCTGCAGGCTCAGAAAGGCCTCTT
ATTCTCGGACCAGCAGCTGTTCTCCGGCGGCCAGAGTTCTCTTATGTCGACTGTCAACACTTACGCCAACAACCAGCAAGCGTTCTTCAGTGCTTTCGCAACTGCCATGGTAAAGATGGG
AAACATCAATCCGCTCACAGGATCAAACGGCCAAATTCGAGCAAACTGCAGGAAGACAAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTATAGTCGAGCGGCAGCGTGGTCGTGTTTGATTGCTGTGATGCTGCTAGGATTCCAAGCCAATGCTCAGCTCAGCTCTTCCTTTTACTCGAGCACCTGTCCCAACCTCATTTCC
ATTGTCCGAACCGCCATCAGCAATGCTGTCAACAGAGAGAACAGGATGGCGGCATCCATTCTCCGTCTCCACTTTCACGATTGCTTTGTAAAC
GGCTGTGATGCATCGATTCTTTTGGAT
GGATCCAGTGGAGAAAAGAACGCAGGGCCAAACGTGAACTCTGCCCGAGGCTTTGATGTCATTGACAATGTCAAGGCCGCGGTGGAGAGCTCCTGCAAAGGCGTTGTTTCGTGTGCCGAC
ATTCTCGCACTCAGCGCGAGGGAAGCCGTTGTTGCG
CTTAGAGGACCGTCTTGGACTGTTGTCTTTGGGCGACGAGATAGCACAACTTCGAGCCAGAGCACTGCAAACTCGGCAATCCCC
CCACCATCGTCCACTGCCTCGAGGCTCATTACCAGCTTCCAGAACCAAGGCCTCTCAACTCAAGATCTCGTAGCGCTGTCTGGCAGTCACACCATCGGCCAGGCCCAGTGCACCAACTTC
CGGGCTCGCCTGTACAATGGCACTTCAGGTGACACCATTGACGCATCATTCAAATCGAACCTGGAGAGGAACTGCCCGAGCACCGGAGGGAACTCGAATCTTGCGCCTCTGGATCTTCAG
ACTCCGGTCACCTTCGACAACCTCTACTTCAAGAATCTGCAGGCTCAGAAAGGCCTCTTATTCTCGGACCAGCAGCTGTTCTCCGGCGGCCAGAGTTCTCTTATGTCGACTGTCAACACT
TACGCCAACAACCAGCAAGCGTTCTTCAGTGCTTTCGCAACTGCCATGGTAAAGATGGGAAACATCAATCCGCTCACAGGATCAAACGGCCAAATTCGAGCAAACTGCAGGAAGACAAAC
TAA

Retrieve as FASTA