Entry information : SmPrx92-1_24 (SmPrx92a_24)
Entry ID 7104
Creation 2009-10-22 (Paula Nunes)
Last sequence changes 2009-10-22 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx92-1_24 (SmPrx92a_24)
Name (synonym) SmPrx92-1_24 (SmPrx92a_24)
Class Class III peroxidase    [Orthogroup: Prx077]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx92-1_24
start..stop
S start..stop
SmPrx93-1_24 629 0 1..318 1..321
SmPrx92-2_26 628 0 1..318 1..318
SmPrx89-1_24 628 0 1..318 1..318
SmPrx93-2_26 627 0 1..318 1..318
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 344259..344462 204 N° 2 344015..344197 183 N° 3 343376..343945 570  
complement(join(343376..343945,344015..344197,344259..344462))


exon

Literature and cross-references SmPrx92-1_24 (SmPrx92a_24)
DNA ref. Phytozome 12:   scaffold_24 (344462..343376)
mRNA ref. JGI transcript:   232269
EST ref. GenBank:   FE479788.1 [5' end]   FE477101.1 [3' end]
Protein sequence: SmPrx92-1_24 (SmPrx92a_24)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   318 (298)
PWM (Da):   %s   33785.55 (31747.4)  
PI (pH):   %s   6.88 (6.73) Peptide Signal:   %s   cut: 21 range:21-318
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MANMSFVLVLLLALHGSALGQTLSSSFYDSSCPNLTTIVRAAVQQAVQAEARIAASFVRLHFHDCFVNGCDASILLDGANLEQNARPNAGSARGFDIVDSIKSSVESSCPGVVSCADLLALIARDSVVALNGPSWTVVFGRRDSLTASQSAANANLPPPTLNASALITSFQNQGLSTTDMVALSGAHTIGQAQCTTFKARLYGPFQRGDQMDQSFNTSLQSSCPSSNGDTNLSPLDVQTPTSFDNRYFRNLQNRRGLLFSDQTLFSGDQASTRNLVNSYASSQSTFFQDFGNAMVRMGNINVLTGSNGEIRRNCGRTN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2) and 3 ESTs (FE479787.1).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAACATGTCCTTTGTGCTTGTGTTGTTGCTGGCTCTGCATGGAAGTGCTCTTGGCCAAACTTTGAGCTCCAGCTTCTACGACTCCTCATGCCCAAATCTCACCACCATCGTGAGA
GCTGCAGTGCAGCAGGCCGTCCAGGCAGAGGCTCGAATCGCAGCCTCGTTTGTTCGCCTCCATTTCCACGACTGCTTTGTCAAT
GTAGAAAGCTTCCATAAGTTTCATTCAAGCATATTG
AAAGAACCATGCATTTGTCTTGCAGGGATGCGATGCTTCCATTCTTCTCGACGGCGCAAACCTGGAGCAAAACGCGCGTCCAAACGCTGGCTCCGCCCGTGGCTTCGACATCGTCGACTC
CATCAAGAGCTCCGTCGAAAGCTCCTGCCCGGGTGTTGTCTCCTGCGCTGACTTACTGGCGCTCATTGCCCGGGACTCCGTAGTCGCG
GTAAACTCTCAAAGTCAACGGTCAAAAGCTTA
CAATGTCAACGCTTTTCGTTTTGTGGTGTTTTTACAGCTGAACGGGCCTTCGTGGACGGTGGTGTTTGGAAGGAGGGATAGCTTAACAGCAAGCCAATCCGCCGCAAATGCCAACCTTCC
TCCTCCAACTTTGAATGCCTCAGCTCTCATCACGAGTTTTCAAAACCAGGGGCTTTCAACCACAGATATGGTGGCTCTCTCCGGGGCTCACACCATTGGGCAGGCCCAGTGCACCACCTT
TAAGGCTCGGCTCTACGGGCCCTTCCAAAGAGGTGACCAGATGGATCAAAGTTTTAACACCTCATTGCAAAGCTCGTGCCCTAGCAGCAATGGCGACACCAATCTCTCGCCGCTCGACGT
CCAGACGCCCACCAGCTTTGACAATCGGTACTTTAGGAACTTGCAGAACCGGAGAGGGTTGCTCTTCTCGGACCAGACGCTCTTTTCCGGGGACCAGGCCAGCACGAGGAATCTCGTCAA
CTCATACGCTTCGAGCCAGAGCACTTTCTTCCAGGACTTTGGCAATGCAATGGTAAGGATGGGCAATATCAATGTGTTGACTGGATCCAATGGAGAGATTCGAAGAAACTGTGGAAGAAC
AAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAACATGTCCTTTGTGCTTGTGTTGTTGCTGGCTCTGCATGGAAGTGCTCTTGGCCAAACTTTGAGCTCCAGCTTCTACGACTCCTCATGCCCAAATCTCACCACCATCGTGAGA
GCTGCAGTGCAGCAGGCCGTCCAGGCAGAGGCTCGAATCGCAGCCTCGTTTGTTCGCCTCCATTTCCACGACTGCTTTGTCAAT
GGATGCGATGCTTCCATTCTTCTCGACGGCGCAAAC
CTGGAGCAAAACGCGCGTCCAAACGCTGGCTCCGCCCGTGGCTTCGACATCGTCGACTCCATCAAGAGCTCCGTCGAAAGCTCCTGCCCGGGTGTTGTCTCCTGCGCTGACTTACTGGCG
CTCATTGCCCGGGACTCCGTAGTCGCG
CTGAACGGGCCTTCGTGGACGGTGGTGTTTGGAAGGAGGGATAGCTTAACAGCAAGCCAATCCGCCGCAAATGCCAACCTTCCTCCTCCAACT
TTGAATGCCTCAGCTCTCATCACGAGTTTTCAAAACCAGGGGCTTTCAACCACAGATATGGTGGCTCTCTCCGGGGCTCACACCATTGGGCAGGCCCAGTGCACCACCTTTAAGGCTCGG
CTCTACGGGCCCTTCCAAAGAGGTGACCAGATGGATCAAAGTTTTAACACCTCATTGCAAAGCTCGTGCCCTAGCAGCAATGGCGACACCAATCTCTCGCCGCTCGACGTCCAGACGCCC
ACCAGCTTTGACAATCGGTACTTTAGGAACTTGCAGAACCGGAGAGGGTTGCTCTTCTCGGACCAGACGCTCTTTTCCGGGGACCAGGCCAGCACGAGGAATCTCGTCAACTCATACGCT
TCGAGCCAGAGCACTTTCTTCCAGGACTTTGGCAATGCAATGGTAAGGATGGGCAATATCAATGTGTTGACTGGATCCAATGGAGAGATTCGAAGAAACTGTGGAAGAACAAACTAG

Retrieve as FASTA