Entry information : SmPrx93-1_24 (SmPrx93a_24)
Entry ID 7105
Creation 2009-10-28 (Christophe Dunand)
Last sequence changes 2011-01-28 (Toky Ramarohetra)
Sequence status complete
Reviewer Nizar Fawal
Last annotation changes 2011-03-03 (Nizar Fawal)
Peroxidase information: SmPrx93-1_24 (SmPrx93a_24)
Name (synonym) SmPrx93-1_24 (SmPrx93a_24)
Class Class III peroxidase    [Orthogroup: Prx077]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx93-1_24
start..stop
S start..stop
SmPrx92-1_24 629 0 1..321 1..318
SmPrx92-2_26 615 0 1..321 1..318
SmPrx93-2_26 614 0 1..321 1..318
SmPrx89-1_24 614 0 1..321 1..318
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 368808..369011 204 N° 2 369072..369263 192 N° 3 369313..369882 570  
join(368808..369011,369072..369263,369313..369882)


exon

Literature and cross-references SmPrx93-1_24 (SmPrx93a_24)
DNA ref. JGI genome:   scaffold_24 (368807..369881)
mRNA ref. JGI transcript:   232270 [Sequencing error]
Protein sequence: SmPrx93-1_24 (SmPrx93a_24)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   321 (301)
PWM (Da):   %s   34164.74 (32092.6)  
PI (pH):   %s   7.71 (7.68) Peptide Signal:   %s   cut: 21 range:21-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MANMSFVLVLFLALHGSALGQTLSSSFYDSSCPNLTTIVRAAVQQAVQAEARIAASFVRLHFHDCFVNGCDASILLDGANLEQNARPNAGSARGFDIVDSIKSSVESSCPGVVSCADLLALIARDGKLSKSTLNGPSWTVVFGRRDSLTASQSAANANLPPPTLNASALITSFQNQGLSTTDMVALSGAHTIGQAQCTTFKARLYGPFQRGDQMDQSFNTSLQSSCPSSNGDTNLSPLDVQTPTSFDNRYFRNLQNRRGLLFSDQTLFSGDQASTRNLVNSYASSQSTFFQDFGNAMVRMGNINVLTGSNGEIRRNCGRTN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2). Incorrect transcript prediction from JGI (sequencing error=> frame shift for the C-term. A G is missing before MGNIN.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAACATGTCCTTTGTGCTTGTGTTGTTTCTGGCTCTGCATGGAAGTGCTCTTGGCCAAACTTTGAGCTCCAGCTTCTACGACTCCTCATGCCCAAATCTCACCACCATCGTGAGA
GCTGCAGTGCAGCAGGCCGTCCAGGCAGAGGCTCGAATCGCAGCCTCGTTTGTTCGCCTCCATTTCCACGACTGCTTTGTCAAT
GTAGAATCTTCCATAAGTTTCATTCAAGCATATTGA
AAGAGCCATGCATTTGTCTTGCAGGGATGCGATGCTTCCATTCTTCTCGACGGCGCAAACCTGGAGCAAAACGCGCGTCCAAACGCTGGCTCCGCCCGTGGCTTCGACATCGTCGACTCC
ATCAAGAGCTCCGTCGAGAGCTCCTGCCCGGGTGTTGTCTCCTGCGCTGACTTACTGGCGCTCATTGCCCGGGACGGTAAACTCTCAAAGTCAACG
GTCAAAAGCTTACAATGTCAACGC
TTTTCGTTTTGTGGTGTTTTTACAGCTGAACGGGCCTTCGTGGACGGTGGTGTTTGGAAGGAGGGATAGCTTAACAGCAAGCCAATCCGCCGCAAATGCCAACCTTCCTCCTCCAACTTT
GAATGCCTCAGCTCTCATCACGAGTTTTCAAAACCAGGGGCTTTCAACCACAGATATGGTGGCTCTCTCCGGGGCTCACACCATTGGGCAGGCCCAGTGCACCACCTTTAAGGCTCGGCT
CTACGGGCCCTTCCAAAGAGGTGACCAGATGGATCAAAGTTTTAACACCTCATTGCAAAGCTCGTGCCCGAGCAGCAATGGCGACACCAATCTCTCGCCGCTCGACGTCCAGACGCCCAC
CAGCTTTGACAATCGGTACTTTAGGAACTTGCAGAACCGGAGAGGGTTGCTCTTCTCGGACCAGACGCTCTTTTCCGGGGACCAGGCCAGCACGAGGAATCTCGTCAACTCATACGCTTC
GAGCCAGAGCACTTTCTTCCAGGACTTTGGCAATGCAATGGTAAGGATGGGCAATATCAATGTGTTGACTGGATCCAATGGAGAGATTCGAAGAAACTGTGGAAGAACAAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAACATGTCCTTTGTGCTTGTGTTGTTTCTGGCTCTGCATGGAAGTGCTCTTGGCCAAACTTTGAGCTCCAGCTTCTACGACTCCTCATGCCCAAATCTCACCACCATCGTGAGA
GCTGCAGTGCAGCAGGCCGTCCAGGCAGAGGCTCGAATCGCAGCCTCGTTTGTTCGCCTCCATTTCCACGACTGCTTTGTCAAT
GGATGCGATGCTTCCATTCTTCTCGACGGCGCAAAC
CTGGAGCAAAACGCGCGTCCAAACGCTGGCTCCGCCCGTGGCTTCGACATCGTCGACTCCATCAAGAGCTCCGTCGAGAGCTCCTGCCCGGGTGTTGTCTCCTGCGCTGACTTACTGGCG
CTCATTGCCCGGGACGGTAAACTCTCAAAGTCAACG
CTGAACGGGCCTTCGTGGACGGTGGTGTTTGGAAGGAGGGATAGCTTAACAGCAAGCCAATCCGCCGCAAATGCCAACCTTCCT
CCTCCAACTTTGAATGCCTCAGCTCTCATCACGAGTTTTCAAAACCAGGGGCTTTCAACCACAGATATGGTGGCTCTCTCCGGGGCTCACACCATTGGGCAGGCCCAGTGCACCACCTTT
AAGGCTCGGCTCTACGGGCCCTTCCAAAGAGGTGACCAGATGGATCAAAGTTTTAACACCTCATTGCAAAGCTCGTGCCCGAGCAGCAATGGCGACACCAATCTCTCGCCGCTCGACGTC
CAGACGCCCACCAGCTTTGACAATCGGTACTTTAGGAACTTGCAGAACCGGAGAGGGTTGCTCTTCTCGGACCAGACGCTCTTTTCCGGGGACCAGGCCAGCACGAGGAATCTCGTCAAC
TCATACGCTTCGAGCCAGAGCACTTTCTTCCAGGACTTTGGCAATGCAATGGTAAGGATGGGCAATATCAATGTGTTGACTGGATCCAATGGAGAGATTCGAAGAAACTGTGGAAGAACA
AACTAG

Retrieve as FASTA