Entry information : SmPrx87-2_26 (SmPrx87b_26)
Entry ID 7106
Creation 2009-10-30 (Christophe Dunand)
Last sequence changes 2009-10-30 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-09-04 (Qiang Li)
Peroxidase information: SmPrx87-2_26 (SmPrx87b_26)
Name (synonym) SmPrx87-2_26 (SmPrx87b_26)
Class Class III peroxidase    [Orthogroup: Prx077]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx87-2_26
start..stop
S start..stop
SmPrx87-1_24 648 0 1..320 1..320
SmPrx88-1_24 427 1e-151 6..320 6..320
SmPrx88-2_26 424 2e-150 6..320 6..321
SmPrx58-2_33 420 5e-149 12..320 3..315
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1887244..1887456 213 N° 2 1886985..1887167 183 N° 3 1886324..1886890 567  
complement(join(1886324..1886890,1886985..1887167,1887244..1887456))


exon

Literature and cross-references SmPrx87-2_26 (SmPrx87b_26)
DNA ref. Phytozome 12:   scaffold_26 (1887456..1886324)
mRNA ref. JGI transcript:   232491 [Incorrect prediction]
Protein sequence: SmPrx87-2_26 (SmPrx87b_26)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320 (296)
PWM (Da):   %s   33823.71 (31256.4) Transmb domain:   %s   i7-24o
PI (pH):   %s   8.65 (8.58) Peptide Signal:   %s   cut: 25 range:25-320
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAYSRAAVWSCLIAVMLLGFQANAQLSSSFYSSTCPNLISIVRTAITNAVNRENRMAASILRLHFHDCFVNGCDASILLDGSSGEKNAGPNVNSARGFDVIDNVKAAVESSCKGVVSCADILALSAREAVVALRGPSWTVVFGRRDSTTSSQSTANSAIPPPSSTASRLITSFQNQGLSTQDLVALSGSHTIGQAQCTNFRARLYNGTSGDTIDASFKSNLERNCPSTGGNSNLAPLDLQTPVTFDNLYFKNLQAQKGLLFSDQQLFSGGQSSLMSTVNTYANNQQAFFSAFATAMVKMGNINPLTGSNGQIRANCRKTN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Incorrect transcript prediction from JGI (fusion of two exon 1 from one ORF with exons 2,3,4 from a second ORF).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTATAGTCGAGCGGCAGTGTGGTCGTGTTTGATTGCTGTGATGCTGCTAGGATTCCAAGCCAATGCTCAGCTCAGCTCTTCCTTCTACTCGAGCACCTGTCCCAACCTCATTTCC
ATTGTCCGAACCGCCATCACCAATGCTGTCAACAGGGAGAACAGGATGGCGGCATCCATTCTCCGTCTCCACTTTCACGATTGCTTTGTAAAC
GTAAGCTGGAGTCTCTGAGATCCCAAA
AAGTTGTCGCCTGACTTGTCTTTCCTTTTCTTTCCTCTGTCTCTTGTAGGGCTGTGATGCATCGATTCTTTTGGATGGATCCAGTGGAGAAAAGAACGCAGGGCCAAACGTGAACTCCGC
CCGAGGCTTTGATGTCATTGACAATGTCAAGGCCGCGGTGGAGAGCTCCTGCAAAGGCGTTGTTTCGTGTGCCGACATTCTCGCACTCAGCGCGAGGGAAGCCGTTGTTGCG
GTAACGAT
TTCTATCCTATCCTTACCTCGTCTGATACTTCGTTCCTCCGAAGCTACCCTAAACCAGAGCATTTTGAAAACTTCTGATGGTGCAGCTTAGAGGACCGTCTTGGACTGTTGTCTTTGGGC
GACGAGATAGCACAACTTCGAGCCAGAGCACTGCAAACTCGGCAATCCCCCCACCATCGTCCACTGCCTCGAGGCTCATTACCAGCTTCCAGAACCAAGGCCTCTCAACTCAAGATCTCG
TAGCGCTGTCTGGCAGTCACACCATCGGCCAGGCCCAGTGCACCAACTTCCGAGCTCGCCTCTACAATGGCACTTCAGGTGACACCATTGACGCATCATTCAAATCGAACCTGGAGAGGA
ACTGCCCCAGCACCGGAGGGAACTCGAATCTTGCGCCTCTGGATCTTCAGACTCCGGTCACCTTCGACAACCTCTACTTCAAGAATCTGCAGGCTCAGAAAGGCCTCTTATTCTCGGACC
AGCAGCTGTTCTCCGGCGGCCAGAGTTCTCTTATGTCGACTGTCAACACTTACGCCAACAACCAGCAAGCGTTCTTCAGTGCTTTCGCAACTGCCATGGTGAAGATGGGAAACATCAATC
CGCTCACAGGATCCAATGGCCAAATTCGAGCAAACTGCAGGAAGACAAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTATAGTCGAGCGGCAGTGTGGTCGTGTTTGATTGCTGTGATGCTGCTAGGATTCCAAGCCAATGCTCAGCTCAGCTCTTCCTTCTACTCGAGCACCTGTCCCAACCTCATTTCC
ATTGTCCGAACCGCCATCACCAATGCTGTCAACAGGGAGAACAGGATGGCGGCATCCATTCTCCGTCTCCACTTTCACGATTGCTTTGTAAAC
GGCTGTGATGCATCGATTCTTTTGGAT
GGATCCAGTGGAGAAAAGAACGCAGGGCCAAACGTGAACTCCGCCCGAGGCTTTGATGTCATTGACAATGTCAAGGCCGCGGTGGAGAGCTCCTGCAAAGGCGTTGTTTCGTGTGCCGAC
ATTCTCGCACTCAGCGCGAGGGAAGCCGTTGTTGCG
CTTAGAGGACCGTCTTGGACTGTTGTCTTTGGGCGACGAGATAGCACAACTTCGAGCCAGAGCACTGCAAACTCGGCAATCCCC
CCACCATCGTCCACTGCCTCGAGGCTCATTACCAGCTTCCAGAACCAAGGCCTCTCAACTCAAGATCTCGTAGCGCTGTCTGGCAGTCACACCATCGGCCAGGCCCAGTGCACCAACTTC
CGAGCTCGCCTCTACAATGGCACTTCAGGTGACACCATTGACGCATCATTCAAATCGAACCTGGAGAGGAACTGCCCCAGCACCGGAGGGAACTCGAATCTTGCGCCTCTGGATCTTCAG
ACTCCGGTCACCTTCGACAACCTCTACTTCAAGAATCTGCAGGCTCAGAAAGGCCTCTTATTCTCGGACCAGCAGCTGTTCTCCGGCGGCCAGAGTTCTCTTATGTCGACTGTCAACACT
TACGCCAACAACCAGCAAGCGTTCTTCAGTGCTTTCGCAACTGCCATGGTGAAGATGGGAAACATCAATCCGCTCACAGGATCCAATGGCCAAATTCGAGCAAACTGCAGGAAGACAAAC
TAA

Retrieve as FASTA