Entry information : SmPrx89-2_26 (SmPrx89b_26)
Entry ID 7107
Creation 2009-10-22 (Paula Nunes)
Last sequence changes 2009-10-22 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx89-2_26 (SmPrx89b_26)
Name (synonym) SmPrx89-2_26 (SmPrx89b_26)
Class Class III peroxidase    [Orthogroup: Prx077]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx89-2_26
start..stop
S start..stop
SmPrx89-1_24 629 0 1..318 1..318
SmPrx93-2_26 629 0 1..318 1..318
SmPrx92-1_24 625 0 1..318 1..318
SmPrx107-1_48 622 0 1..318 1..318
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1893165..1893368 204 N° 2 1893430..1893612 183 N° 3 1893682..1894251 570  
join(1893165..1893368,1893430..1893612,1893682..1894251)


exon

Literature and cross-references SmPrx89-2_26 (SmPrx89b_26)
DNA ref. Phytozome 12:   scaffold_26 (1893165..1894251)
mRNA ref. JGI transcript:   228326
Protein sequence: SmPrx89-2_26 (SmPrx89b_26)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   318 (298)
PWM (Da):   %s   33847.77 (31810.6)  
PI (pH):   %s   7.99 (7.98) Peptide Signal:   %s   cut: 21 range:21-318
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAIMSFVLVLLLALHGSALGQTLSSSFYRSSCPNLTTIVRAAVQQAVQAEARIAASFVRLHFHDCFVNGCDASILLDGANLEQNARPNAGSARGFDIVDSIKSSVESSCPGVVSCADLLALIARDSVVALNGPSWTVVFGRRDSLTASQSAANANLPPPTLNASALIASFQNQGLSTRDMVALSGAHTIGQARCITFKARLYGPFQIGDQMDQSFNTSLQSSCPSSNGDTNLSPLDVQTPTSFDNRYFRNLQNRRGLLFSDQTLFSGDQASTRNLVNSYASSQSTFFQDFGNAMVRMGNINVLTGSNGEIRRNCGRTN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGATCATGTCCTTTGTGCTTGTGTTGTTGCTGGCCCTGCATGGGAGTGCTCTTGGCCAAACTTTGAGCTCCAGCTTCTACCGCTCCTCGTGCCCAAATCTCACCACCATCGTGAGA
GCTGCAGTGCAGCAGGCCGTCCAGGCAGAGGCTCGAATCGCAGCCTCGTTTGTTCGCCTCCATTTCCACGACTGCTTTGTCAAT
GTAGAAAGCTTCCATAAGTTTCATTCAAGCATATTG
AAAGAACCATGCATTTGTCTTGCAGGGATGCGATGCTTCCATTCTTCTCGACGGCGCAAACCTGGAGCAAAACGCGCGTCCAAACGCTGGCTCCGCCCGTGGCTTCGACATCGTCGACTC
CATCAAGAGCTCCGTCGAAAGCTCCTGCCCGGGTGTTGTCTCCTGCGCTGACTTACTGGCGCTCATTGCCCGGGACTCCGTAGTCGCG
GTAAACTCTCAAAGTCAACGGTCAAAAGCTTA
CAATGTCAACGCTTTTCGTTTTGTGGTGTTTTTACAGCTGAACGGGCCATCGTGGACGGTGGTGTTTGGAAGGAGGGATAGCTTAACAGCAAGCCAATCTGCCGCAAATGCCAACCTTCC
TCCTCCAACTTTGAATGCCTCAGCGCTCATCGCGAGTTTCCAAAACCAGGGGCTTTCAACCAGAGATATGGTGGCTCTCTCTGGGGCTCACACCATTGGGCAGGCCCGGTGCATCACCTT
TAAGGCTCGGCTCTACGGGCCCTTCCAAATAGGTGACCAGATGGATCAAAGTTTTAACACCTCGTTGCAAAGCTCGTGCCCGAGCAGCAATGGCGACACCAATCTCTCGCCGCTCGACGT
CCAGACGCCCACCAGCTTTGACAACCGCTACTTTAGGAACTTGCAGAACCGGAGAGGGTTGCTTTTCTCGGACCAGACGCTCTTTTCCGGGGACCAGGCCAGCACGAGGAATCTCGTCAA
CTCATACGCTTCGAGCCAGAGCACTTTCTTCCAGGACTTTGGCAATGCAATGGTAAGGATGGGTAATATCAATGTGTTGACTGGATCCAATGGAGAGATTCGAAGAAACTGTGGAAGAAC
AAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGATCATGTCCTTTGTGCTTGTGTTGTTGCTGGCCCTGCATGGGAGTGCTCTTGGCCAAACTTTGAGCTCCAGCTTCTACCGCTCCTCGTGCCCAAATCTCACCACCATCGTGAGA
GCTGCAGTGCAGCAGGCCGTCCAGGCAGAGGCTCGAATCGCAGCCTCGTTTGTTCGCCTCCATTTCCACGACTGCTTTGTCAAT
GGATGCGATGCTTCCATTCTTCTCGACGGCGCAAAC
CTGGAGCAAAACGCGCGTCCAAACGCTGGCTCCGCCCGTGGCTTCGACATCGTCGACTCCATCAAGAGCTCCGTCGAAAGCTCCTGCCCGGGTGTTGTCTCCTGCGCTGACTTACTGGCG
CTCATTGCCCGGGACTCCGTAGTCGCG
CTGAACGGGCCATCGTGGACGGTGGTGTTTGGAAGGAGGGATAGCTTAACAGCAAGCCAATCTGCCGCAAATGCCAACCTTCCTCCTCCAACT
TTGAATGCCTCAGCGCTCATCGCGAGTTTCCAAAACCAGGGGCTTTCAACCAGAGATATGGTGGCTCTCTCTGGGGCTCACACCATTGGGCAGGCCCGGTGCATCACCTTTAAGGCTCGG
CTCTACGGGCCCTTCCAAATAGGTGACCAGATGGATCAAAGTTTTAACACCTCGTTGCAAAGCTCGTGCCCGAGCAGCAATGGCGACACCAATCTCTCGCCGCTCGACGTCCAGACGCCC
ACCAGCTTTGACAACCGCTACTTTAGGAACTTGCAGAACCGGAGAGGGTTGCTTTTCTCGGACCAGACGCTCTTTTCCGGGGACCAGGCCAGCACGAGGAATCTCGTCAACTCATACGCT
TCGAGCCAGAGCACTTTCTTCCAGGACTTTGGCAATGCAATGGTAAGGATGGGTAATATCAATGTGTTGACTGGATCCAATGGAGAGATTCGAAGAAACTGTGGAAGAACAAACTAG

Retrieve as FASTA