Entry information : SmPrx92-2_26 (SmPrx92b_26)
Entry ID 7109
Creation 2009-10-23 (Paula Nunes)
Last sequence changes 2009-10-23 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx92-2_26 (SmPrx92b_26)
Name (synonym) SmPrx92-2_26 (SmPrx92b_26)
Class Class III peroxidase    [Orthogroup: Prx077]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx92-2_26
start..stop
S start..stop
SmPrx92-1_24 628 0 1..318 1..318
SmPrx93-2_26 627 0 1..318 1..318
SmPrx89-1_24 627 0 1..318 1..318
SmPrx107-1_48 624 0 1..318 1..318
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1927172..1927375 204 N° 2 1926928..1927110 183 N° 3 1926289..1926858 570  
complement(join(1926289..1926858,1926928..1927110,1927172..1927375))


exon

Literature and cross-references SmPrx92-2_26 (SmPrx92b_26)
DNA ref. Phytozome 12:   scaffold_26 (1927375..1926289)
mRNA ref. JGI transcript:   102433
EST ref. GenBank:   FE496746.1 [5' end]   FE496745.1 [3' end]
Protein sequence: SmPrx92-2_26 (SmPrx92b_26)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   318 (298)
PWM (Da):   %s   33672.51 (31635.4)  
PI (pH):   %s   6.09 (5.68) Peptide Signal:   %s   cut: 21 range:21-318
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAIMSFVLVLLLALHGSALGQTLSSSFYGSSCPNLTTIVRDAVQQAVQAEARIAASFVRLHFHDCFVNGCDASILLDGANLEQNALPNAGSARGFDIVDSIKSSVESSCPGVVSCADLLALIARDSVVALNGPSWTVVFGRRDSLTASQSAANANLPPPTLNASALITSFQNQGLSTTDMVALSGAHTIGQAQCTTFKARLYGPFQRGDQMDQSFNTSLQSSCPSSNGDTNLSPLDVQTPTSFDNRYFRNLQNRTGLLFSDQTLFSGDQASTRNLVNSYASSQSTFFQDFGNAMVRMGNINVLTGSNGEIRRNCGRTN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2) and 2 ESTs.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGATCATGTCCTTTGTGCTTGTGTTGTTGCTGGCTCTGCATGGAAGTGCTCTTGGCCAAACTTTGAGCTCCAGCTTCTACGGCTCCTCGTGCCCAAATCTCACCACCATCGTGAGA
GATGCAGTGCAGCAGGCCGTCCAGGCAGAGGCTCGAATCGCAGCCTCGTTTGTTCGCCTCCATTTCCACGACTGCTTTGTCAAT
GTAGAAAGCTTCCATAACTTTCATTCAAGCATATTG
AAAGAACCATGCATTTGTCTTGCAGGGATGTGATGCTTCCATTCTTCTCGATGGCGCAAACCTGGAGCAAAACGCGCTTCCAAACGCTGGCTCCGCCCGTGGCTTCGACATCGTCGACTC
CATCAAGAGCTCCGTCGAGAGCTCCTGCCCGGGCGTTGTCTCCTGCGCTGACTTACTGGCGCTCATTGCCCGGGACTCCGTAGTCGCG
GTAAACTCTCAAAGTCAACGGTCAAAAGCTTA
CAATGTCAACGCTTTTCGTTTTGTGGTGTTTTTACAGCTGAACGGGCCTTCGTGGACGGTGGTGTTTGGAAGGAGGGATAGCTTAACAGCAAGCCAATCTGCCGCAAATGCCAACCTTCC
TCCTCCAACTTTGAATGCCTCAGCTCTCATCACGAGTTTTCAAAACCAGGGGCTTTCAACCACAGATATGGTGGCTCTCTCCGGGGCTCACACCATTGGGCAGGCCCAGTGCACCACCTT
TAAGGCTCGGCTCTACGGGCCCTTCCAAAGAGGTGACCAGATGGATCAAAGTTTTAACACCTCATTGCAAAGCTCGTGCCCGAGCAGCAATGGCGACACCAATCTCTCGCCGCTCGACGT
CCAGACGCCCACCAGCTTTGACAATCGGTACTTTAGGAACTTGCAGAACCGGACAGGGTTGCTCTTCTCGGACCAGACGCTCTTTTCCGGGGACCAGGCCAGCACGAGGAATCTCGTCAA
CTCATACGCTTCGAGCCAGAGCACTTTCTTCCAGGACTTTGGCAATGCAATGGTAAGGATGGGCAATATCAATGTGTTGACTGGATCCAATGGAGAGATTCGAAGAAACTGTGGAAGAAC
AAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGATCATGTCCTTTGTGCTTGTGTTGTTGCTGGCTCTGCATGGAAGTGCTCTTGGCCAAACTTTGAGCTCCAGCTTCTACGGCTCCTCGTGCCCAAATCTCACCACCATCGTGAGA
GATGCAGTGCAGCAGGCCGTCCAGGCAGAGGCTCGAATCGCAGCCTCGTTTGTTCGCCTCCATTTCCACGACTGCTTTGTCAAT
GGATGTGATGCTTCCATTCTTCTCGATGGCGCAAAC
CTGGAGCAAAACGCGCTTCCAAACGCTGGCTCCGCCCGTGGCTTCGACATCGTCGACTCCATCAAGAGCTCCGTCGAGAGCTCCTGCCCGGGCGTTGTCTCCTGCGCTGACTTACTGGCG
CTCATTGCCCGGGACTCCGTAGTCGCG
CTGAACGGGCCTTCGTGGACGGTGGTGTTTGGAAGGAGGGATAGCTTAACAGCAAGCCAATCTGCCGCAAATGCCAACCTTCCTCCTCCAACT
TTGAATGCCTCAGCTCTCATCACGAGTTTTCAAAACCAGGGGCTTTCAACCACAGATATGGTGGCTCTCTCCGGGGCTCACACCATTGGGCAGGCCCAGTGCACCACCTTTAAGGCTCGG
CTCTACGGGCCCTTCCAAAGAGGTGACCAGATGGATCAAAGTTTTAACACCTCATTGCAAAGCTCGTGCCCGAGCAGCAATGGCGACACCAATCTCTCGCCGCTCGACGTCCAGACGCCC
ACCAGCTTTGACAATCGGTACTTTAGGAACTTGCAGAACCGGACAGGGTTGCTCTTCTCGGACCAGACGCTCTTTTCCGGGGACCAGGCCAGCACGAGGAATCTCGTCAACTCATACGCT
TCGAGCCAGAGCACTTTCTTCCAGGACTTTGGCAATGCAATGGTAAGGATGGGCAATATCAATGTGTTGACTGGATCCAATGGAGAGATTCGAAGAAACTGTGGAAGAACAAACTAG

Retrieve as FASTA