Entry information : SmPrx95-1_32 (SmPrx95a_32)
Entry ID 7111
Creation 2009-10-22 (Paula Nunes)
Last sequence changes 2009-10-22 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx95-1_32 (SmPrx95a_32)
Name (synonym) SmPrx95-1_32 (SmPrx95a_32)
Class Class III peroxidase    [Orthogroup: Prx030]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx95-1_32
start..stop
S start..stop
SmPrx95-2_45 669 0 1..325 1..325
MePrx17 347 9e-120 12..325 22..333
EguPrx73 345 3e-119 10..325 9..325
EcamPrx73 345 5e-119 12..325 14..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1722453..1722665 213 N° 2 1722215..1722403 189 N° 3 1721988..1722153 166 N° 4 1721525..1721934 410
complement(join(1721525..1721934,1721988..1722153,1722215..1722403,1722453..1722 665))


exon

Literature and cross-references SmPrx95-1_32 (SmPrx95a_32)
DNA ref. Phytozome 12:   scaffold_32 (1722665..1721525)
mRNA ref. JGI transcript:   106106
Protein sequence: SmPrx95-1_32 (SmPrx95a_32)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (301)
PWM (Da):   %s   35284.75 (32690.4) Transmb domain:   %s   i12-31o
PI (pH):   %s   8.1 (7.41) Peptide Signal:   %s   cut: 25 range:25-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGTSVRHWKQRLVLVCLALGSVCGQLAFDFYANSCPRVEAVVANAIRSATFFDSTLPPKLLRLMFHDCFIEGCDGSILVDSTANHTAEKEDESNKTVDGYAAIDSAKSALEFFCPGVVSCADIVALAAREAVIMMGGPQVQIPMGRRDGLISKVSNVRGNIPDTTLTLDQLTKVFNSKGLSQKDLIVLSGAHTVGLAHCFAFNERFHFSSNGSVKVDSTLDPGFARQLLQACPERPNPRVAVAIDPTTPNAFDNAYYRNLQNGKGLFGSDQVLFTDRRSRQAVNSLSGDSREFFGSWADSFLKLSVVHTKTGNQGEVRRRCRAFN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAACCTCTGTGCGGCATTGGAAGCAGCGGCTGGTTTTAGTGTGCTTAGCGCTTGGATCGGTTTGCGGTCAGCTGGCATTTGATTTCTACGCCAACAGTTGTCCCAGGGTCGAAGCA
GTAGTCGCAAACGCAATCAGGAGTGCCACATTCTTTGATTCTACGCTGCCACCAAAACTTCTCCGGCTTATGTTCCACGATTGCTTCATTGAG
GTACAAACTCGCAAAGCAGTCCAAATT
GTCATGGTTTTTTGTTCGTCAGGGATGTGATGGTTCCATTTTGGTCGATTCAACCGCGAATCATACGGCTGAAAAGGAGGACGAATCCAACAAAACTGTTGATGGTTATGCTGCCATCGA
TTCTGCAAAATCCGCGCTGGAGTTCTTCTGCCCTGGAGTTGTTTCGTGCGCTGATATTGTGGCCTTGGCTGCTCGGGAGGCGGTAATCATG
GTAAGTCGAAACGTAAAATTGCGTTTTCT
ATCTCACTTCGTTTTCTGTTTTCAAATTGTAGATGGGTGGACCACAGGTACAAATACCTATGGGCCGAAGAGACGGGTTGATTTCTAAGGTTTCCAATGTGCGTGGAAACATACCGGACA
CTACACTTACCTTGGACCAGCTCACCAAAGTCTTCAACTCGAAAGGATTGTCTCAAAAGGACCTCATCGTTCTCTCAG
GTATAAAGAAGTTTTCGTTCGAAGTCTTGTTCTCAAGTGGAT
GGATTTTCCAGGAGCGCACACCGTCGGCCTGGCACACTGTTTTGCATTCAACGAGCGCTTCCACTTCAGCAGCAATGGCAGCGTCAAAGTGGACTCGACACTCGACCCCGGATTCGCAAG
GCAGCTGCTCCAGGCGTGTCCTGAGAGGCCGAATCCCAGAGTCGCGGTAGCGATCGATCCCACCACCCCAAACGCCTTCGACAACGCGTACTACAGGAATCTCCAGAACGGGAAAGGACT
GTTTGGATCCGACCAAGTTCTCTTCACGGACCGGAGAAGCAGGCAGGCGGTGAACTCGTTGTCGGGCGACAGCCGAGAGTTTTTCGGGTCGTGGGCGGACTCGTTTCTCAAGCTCAGCGT
TGTACATACCAAGACTGGAAACCAGGGAGAGGTTAGGAGAAGGTGTAGAGCTTTCAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAACCTCTGTGCGGCATTGGAAGCAGCGGCTGGTTTTAGTGTGCTTAGCGCTTGGATCGGTTTGCGGTCAGCTGGCATTTGATTTCTACGCCAACAGTTGTCCCAGGGTCGAAGCA
GTAGTCGCAAACGCAATCAGGAGTGCCACATTCTTTGATTCTACGCTGCCACCAAAACTTCTCCGGCTTATGTTCCACGATTGCTTCATTGAG
GGATGTGATGGTTCCATTTTGGTCGAT
TCAACCGCGAATCATACGGCTGAAAAGGAGGACGAATCCAACAAAACTGTTGATGGTTATGCTGCCATCGATTCTGCAAAATCCGCGCTGGAGTTCTTCTGCCCTGGAGTTGTTTCGTGC
GCTGATATTGTGGCCTTGGCTGCTCGGGAGGCGGTAATCATG
ATGGGTGGACCACAGGTACAAATACCTATGGGCCGAAGAGACGGGTTGATTTCTAAGGTTTCCAATGTGCGTGGAAAC
ATACCGGACACTACACTTACCTTGGACCAGCTCACCAAAGTCTTCAACTCGAAAGGATTGTCTCAAAAGGACCTCATCGTTCTCTCAG
GAGCGCACACCGTCGGCCTGGCACACTGTTTT
GCATTCAACGAGCGCTTCCACTTCAGCAGCAATGGCAGCGTCAAAGTGGACTCGACACTCGACCCCGGATTCGCAAGGCAGCTGCTCCAGGCGTGTCCTGAGAGGCCGAATCCCAGAGTC
GCGGTAGCGATCGATCCCACCACCCCAAACGCCTTCGACAACGCGTACTACAGGAATCTCCAGAACGGGAAAGGACTGTTTGGATCCGACCAAGTTCTCTTCACGGACCGGAGAAGCAGG
CAGGCGGTGAACTCGTTGTCGGGCGACAGCCGAGAGTTTTTCGGGTCGTGGGCGGACTCGTTTCTCAAGCTCAGCGTTGTACATACCAAGACTGGAAACCAGGGAGAGGTTAGGAGAAGG
TGTAGAGCTTTCAATTAA

Retrieve as FASTA