Entry information : SmPrx95-2_45 (SmPrx95b_45)
Entry ID 7112
Creation 2009-10-22 (Paula Nunes)
Last sequence changes 2009-10-22 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx95-2_45 (SmPrx95b_45)
Name (synonym) SmPrx95-2_45 (SmPrx95b_45)
Class Class III peroxidase    [Orthogroup: Prx030]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx95-2_45
start..stop
S start..stop
SmPrx95-1_32 669 0 1..325 1..325
MePrx17 346 2e-119 12..325 22..333
EguPrx73 344 5e-119 10..325 9..325
EcamPrx73 344 9e-119 12..325 14..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1299807..1300019 213 N° 2 1299569..1299757 189 N° 3 1299341..1299506 166 N° 4 1298882..1299291 410
complement(join(1298882..1299291,1299341..1299506,1299569..1299757,1299807..1300 019))


exon

Literature and cross-references SmPrx95-2_45 (SmPrx95b_45)
DNA ref. Phytozome 12:   scaffold_45 (1300019..1298882)
mRNA ref. JGI transcript:   178409
EST ref. GenBank:   FE443667.1 [3' end]
Protein sequence: SmPrx95-2_45 (SmPrx95b_45)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (301)
PWM (Da):   %s   35270.74 (32676.4) Transmb domain:   %s   i12-31o
PI (pH):   %s   8.1 (7.41) Peptide Signal:   %s   cut: 25 range:25-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGTSVRHWKQRLVLVCLALGSVCGQLAFDFYANSCPRVEAVVANAIRSATFFDSTLPPKLLRLMFHDCFIEGCDGSILIDSTANHTAEKEDESNKTADGYAAIDSAKSALEFFCPGVVSCADIVALAAREAVIMMGGPQVQIPMGRRDGLISKVSNVRGNIPDTTLTLDQLTKVFNSKGLSQKDLIVLSGAHTVGLAHCFAFNERFHFSSNGSVKVDSTLDPGFARQLLQACPERPNPRVAVAIDPTTPNAFDNAYYRNLQNGKGLFGSDQVLFTDRRSRQAVNSLSGDSREFFGSWADSFLKLSVVHTKTGNQGEVRRRCRAFN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns) and 2 ESTs (FE445985.1).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAACCTCTGTGCGGCATTGGAAGCAGCGGCTGGTTTTAGTGTGCTTAGCGCTTGGATCGGTTTGCGGTCAGCTGGCATTTGATTTCTACGCCAACAGTTGTCCCAGGGTCGAAGCA
GTAGTCGCAAACGCAATCAGGAGTGCCACATTCTTTGATTCTACGCTGCCACCAAAACTTCTCCGGCTCATGTTCCACGATTGCTTCATTGAG
GTACAAACTCGCAAAGCAGTCCAAATT
GTCATGGTTTTTTGTTCGTCAGGGATGTGATGGTTCCATTTTGATCGACTCTACTGCGAATCATACGGCTGAAAAGGAGGACGAATCCAACAAAACTGCTGATGGTTATGCGGCCATCGA
TTCTGCAAAATCCGCGCTGGAGTTCTTCTGCCCTGGAGTTGTTTCGTGCGCGGATATTGTGGCCTTGGCTGCTCGGGAGGCGGTAATCATG
GTAAGTCGAAACGTAAAATTTGCGTTTTC
TATCTCACTTCGTTTTCTGTTTCCAAATTGTAGATGGGTGGACCACAGGTACAAATACCTATGGGCCGAAGAGACGGGTTGATTTCTAAGGTTTCCAATGTGCGTGGAAACATACCGGAC
ACTACACTTACCTTGGACCAGCTCACCAAAGTCTTCAACTCGAAAGGATTGTCTCAAAAGGACCTCATCGTTCTCTCAG
GTATAAAGAAGTTCTCGAAGCCTTGTTCTCAAGTGGATGGA
TTTTCCAGGAGCGCACACCGTCGGCCTGGCACACTGTTTTGCATTCAACGAGCGCTTCCACTTCAGCAGCAATGGCAGCGTCAAAGTGGACTCGACACTCGACCCCGGATTCGCAAGGCA
GCTGCTCCAGGCGTGTCCTGAGAGGCCGAATCCCAGAGTCGCGGTAGCGATCGATCCCACCACCCCAAACGCCTTCGACAACGCGTACTACAGGAATCTCCAGAACGGGAAAGGGCTGTT
TGGATCCGACCAAGTTCTCTTCACGGACCGGAGAAGCAGGCAGGCGGTGAACTCGTTGTCGGGCGACAGCCGAGAGTTTTTTGGGTCGTGGGCGGACTCGTTTCTCAAGCTCAGCGTTGT
ACATACCAAGACTGGAAACCAGGGAGAGGTTAGGAGAAGGTGTAGAGCTTTCAATTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGAACCTCTGTGCGGCATTGGAAGCAGCGGCTGGTTTTAGTGTGCTTAGCGCTTGGATCGGTTTGCGGTCAGCTGGCATTTGATTTCTACGCCAACAGTTGTCCCAGGGTCGAAGCA
GTAGTCGCAAACGCAATCAGGAGTGCCACATTCTTTGATTCTACGCTGCCACCAAAACTTCTCCGGCTCATGTTCCACGATTGCTTCATTGAG
GGATGTGATGGTTCCATTTTGATCGAC
TCTACTGCGAATCATACGGCTGAAAAGGAGGACGAATCCAACAAAACTGCTGATGGTTATGCGGCCATCGATTCTGCAAAATCCGCGCTGGAGTTCTTCTGCCCTGGAGTTGTTTCGTGC
GCGGATATTGTGGCCTTGGCTGCTCGGGAGGCGGTAATCATG
ATGGGTGGACCACAGGTACAAATACCTATGGGCCGAAGAGACGGGTTGATTTCTAAGGTTTCCAATGTGCGTGGAAAC
ATACCGGACACTACACTTACCTTGGACCAGCTCACCAAAGTCTTCAACTCGAAAGGATTGTCTCAAAAGGACCTCATCGTTCTCTCAG
GAGCGCACACCGTCGGCCTGGCACACTGTTTT
GCATTCAACGAGCGCTTCCACTTCAGCAGCAATGGCAGCGTCAAAGTGGACTCGACACTCGACCCCGGATTCGCAAGGCAGCTGCTCCAGGCGTGTCCTGAGAGGCCGAATCCCAGAGTC
GCGGTAGCGATCGATCCCACCACCCCAAACGCCTTCGACAACGCGTACTACAGGAATCTCCAGAACGGGAAAGGGCTGTTTGGATCCGACCAAGTTCTCTTCACGGACCGGAGAAGCAGG
CAGGCGGTGAACTCGTTGTCGGGCGACAGCCGAGAGTTTTTTGGGTCGTGGGCGGACTCGTTTCTCAAGCTCAGCGTTGTACATACCAAGACTGGAAACCAGGGAGAGGTTAGGAGAAGG
TGTAGAGCTTTCAATTAA

Retrieve as FASTA