Entry information : SmPrx97-1_50 (SmPrx97a_50)
Entry ID 7113
Creation 2009-10-22 (Paula Nunes)
Last sequence changes 2009-10-22 (Paula Nunes)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx97-1_50 (SmPrx97a_50)
Name (synonym) SmPrx97-1_50 (SmPrx97a_50)
Class Class III peroxidase    [Orthogroup: Prx292]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx97-1_50
start..stop
S start..stop
SmPrx97-2_9 672 0 1..326 1..326
SmPrx36-2_44 348 1e-119 3..323 56..375
SmPrx36-1_2 348 2e-119 3..323 56..375
SmPrx50-2_101 340 3e-117 1..323 1..327
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 957769..957969 201 N° 2 958041..958232 192 N° 3 958293..958880 588  
join(957769..957969,958041..958232,958293..958880)


exon

Literature and cross-references SmPrx97-1_50 (SmPrx97a_50)
DNA ref. Phytozome 12:   scaffold_50 (957769..958880)
mRNA ref. JGI transcript:   114931
Protein sequence: SmPrx97-1_50 (SmPrx97a_50)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (307)
PWM (Da):   %s   35963.85 (33731.7)  
PI (pH):   %s   4.72 (4.85) Peptide Signal:   %s   cut: 20 range:20-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDRAFFLVLILAVIDWSLEEHLTPDFYQDSCPNLETTVRETVNKFVQDEPGIAASLLRLHFHDCFVTGCDASILLDDVPPRLGEKSAPPNSNFFRAYEVIDDVKFQLEQICDGVVSCADLLALAAREAVIASHGPHWKVHYGRRDTTVASLAAAAQDIPFANATTQELITRFENKGLSVDEMVALSGAHTIGQTRCAVVKDRLYDFMGTGQPDPALDKDLLQSLRESCPDTPSSDENFSPLDSQTPLRFDNAYFTDLRSGRGVLRSDQVLYSTPGATKSAVHIYSGDSSQFFEDFGRAMIKLGGLTPLTGKEGEIRRSCRFPNRWI*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2). No EST.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCGAGCATTCTTCCTCGTTTTGATCCTGGCAGTGATTGATTGGAGCCTGGAAGAGCACCTCACTCCGGATTTCTACCAGGATTCCTGTCCCAATCTCGAGACCACAGTGCGAGAG
ACCGTAAATAAGTTCGTCCAGGACGAGCCAGGGATCGCAGCTTCACTCCTTCGCCTACATTTTCACGACTGCTTTGTCACG
GTAAAGTTCGAAGGCAAATCTCACTAGTACCTTGAGTTG
ATCGAAAAGACGGAGCGTAACTTCTTTTGCAGGGCTGCGATGCTTCAATCCTCCTGGACGACGTTCCTCCCAGGCTGGGCGAGAAGAGCGCTCCTCCAAACTCAAACTTTTTTCGAGCTT
ACGAAGTCATCGACGACGTGAAGTTCCAACTGGAGCAAATCTGCGACGGCGTGGTTTCCTGCGCCGATCTCTTGGCTCTAGCTGCAAGAGAAGCCGTCATAGCG
GTGAGCGAAAGGAAAA
TGCCGAGATCAAATCTCTCACCACCATCTTTTCTTCTGTGATAGTCACACGGCCCTCACTGGAAAGTCCACTATGGCCGAAGAGACACCACGGTGGCGAGCTTGGCGGCCGCTGCGCAGG
ACATACCTTTCGCCAACGCCACCACCCAAGAGCTCATCACAAGGTTTGAGAACAAAGGCCTGTCCGTGGACGAAATGGTAGCTCTCTCGGGAGCTCACACAATCGGCCAGACACGCTGCG
CGGTCGTCAAGGATCGCCTCTACGACTTCATGGGAACCGGACAGCCGGATCCAGCGCTGGACAAGGATTTGCTCCAATCCCTCCGTGAATCCTGCCCTGACACGCCCTCGAGCGATGAGA
ATTTCTCCCCTCTCGACTCCCAGACCCCTCTCCGATTCGACAATGCCTACTTCACGGACCTGAGGAGCGGCCGCGGCGTCCTCCGCTCGGATCAAGTGCTCTACTCCACGCCTGGCGCCA
CCAAGAGCGCCGTCCATATCTACAGCGGCGATTCAAGCCAGTTCTTCGAGGATTTCGGGAGAGCGATGATCAAGCTAGGCGGATTGACGCCGCTAACAGGGAAGGAGGGCGAAATCCGCC
GCTCCTGTCGATTCCCAAACCGGTGGATCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATCGAGCATTCTTCCTCGTTTTGATCCTGGCAGTGATTGATTGGAGCCTGGAAGAGCACCTCACTCCGGATTTCTACCAGGATTCCTGTCCCAATCTCGAGACCACAGTGCGAGAG
ACCGTAAATAAGTTCGTCCAGGACGAGCCAGGGATCGCAGCTTCACTCCTTCGCCTACATTTTCACGACTGCTTTGTCACG
GGCTGCGATGCTTCAATCCTCCTGGACGACGTTCCTCCC
AGGCTGGGCGAGAAGAGCGCTCCTCCAAACTCAAACTTTTTTCGAGCTTACGAAGTCATCGACGACGTGAAGTTCCAACTGGAGCAAATCTGCGACGGCGTGGTTTCCTGCGCCGATCTC
TTGGCTCTAGCTGCAAGAGAAGCCGTCATAGCG
TCACACGGCCCTCACTGGAAAGTCCACTATGGCCGAAGAGACACCACGGTGGCGAGCTTGGCGGCCGCTGCGCAGGACATACCTTTC
GCCAACGCCACCACCCAAGAGCTCATCACAAGGTTTGAGAACAAAGGCCTGTCCGTGGACGAAATGGTAGCTCTCTCGGGAGCTCACACAATCGGCCAGACACGCTGCGCGGTCGTCAAG
GATCGCCTCTACGACTTCATGGGAACCGGACAGCCGGATCCAGCGCTGGACAAGGATTTGCTCCAATCCCTCCGTGAATCCTGCCCTGACACGCCCTCGAGCGATGAGAATTTCTCCCCT
CTCGACTCCCAGACCCCTCTCCGATTCGACAATGCCTACTTCACGGACCTGAGGAGCGGCCGCGGCGTCCTCCGCTCGGATCAAGTGCTCTACTCCACGCCTGGCGCCACCAAGAGCGCC
GTCCATATCTACAGCGGCGATTCAAGCCAGTTCTTCGAGGATTTCGGGAGAGCGATGATCAAGCTAGGCGGATTGACGCCGCTAACAGGGAAGGAGGGCGAAATCCGCCGCTCCTGTCGA
TTCCCAAACCGGTGGATCTGA

Retrieve as FASTA