Entry information : SmPrx98-1_50 (SmPrx98a_50)
Entry ID 7114
Creation 2009-10-28 (Christophe Dunand)
Last sequence changes 2009-10-28 (Christophe Dunand)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-09-04 (Qiang Li)
Peroxidase information: SmPrx98-1_50 (SmPrx98a_50)
Name (synonym) SmPrx98-1_50 (SmPrx98a_50)
Class Class III peroxidase    [Orthogroup: Prx073]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx98-1_50
start..stop
S start..stop
SmPrx98-2_9 590 0 1..314 1..314
SmPrx99-1_50 590 0 1..314 1..314
SmPrx102-1_50 588 0 1..314 1..314
SmPrx101-1_50 566 0 1..314 1..314
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1107748..1107996 249 N° 2 1108041..1108199 159 N° 3 1108255..1108791 537  
join(1107748..1107996,1108041..1108199,1108255..1108791)


exon

Literature and cross-references SmPrx98-1_50 (SmPrx98a_50)
DNA ref. Phytozome 12:   scaffold_50 (1107748..1108791)
mRNA ref. JGI transcript:   115017 [Incorrect splicing]
Protein sequence: SmPrx98-1_50 (SmPrx98a_50)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   314 (286)
PWM (Da):   %s   33810.39 (30664.6)  
PI (pH):   %s   9.42 (8.70) Peptide Signal:   %s   cut: 29 range:29-314
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQRSKFQAPVVSAALLLVLALLRRYAFCQGSPTMSLELSTSFYANTCPDLPQIVRSVIRSEFSNESRSAASILKLHFRDCFSRGCDGSLLLQRGDGRSAKGLKIINNVKRAVETSCPATVSCADILALSARESVIALGGPSWTVEFGRRDSPATVAAAMEAIPSPNLTATQLIQSFQRRGLSKRDLVALSGGHSIGQAQCSAFSARLFNGTPGDSIDRAFKSRLEKNCPPTAPDRLTNLDPSPTTFDNLYFRALLANQSLLFSDQQLLEIDLVGFVKEFAANQQTFFTAFANGMIKMGKLSPITAGHGEIRSSC*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2). No EST. Incorrect transcript prediction from JGI (short PS).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCGATCCAAATTCCAGGCTCCAGTCGTCTCTGCAGCATTACTGCTGGTGCTAGCACTGCTGCGGCGCTATGCATTTTGCCAGGGATCACCAACAATGTCATTGGAGCTCTCAACT
TCTTTCTATGCTAACACTTGTCCCGATCTCCCTCAGATCGTGAGAAGTGTGATTCGCTCTGAATTTTCCAACGAAAGTCGATCTGCTGCGTCGATCCTCAAGCTCCACTTCCGAGATTGC
TTCTCTCGA
GTAAGTCAGAAATTAAAATAGCGTTACTCATTTATGGCTGCCAGGGCTGCGACGGATCGCTGCTCCTCCAGCGAGGAGATGGGCGCTCCGCCAAGGGACTCAAAATCATCA
ACAACGTCAAGCGCGCCGTGGAGACTTCATGCCCGGCAACAGTATCGTGCGCGGACATTCTTGCGCTGAGCGCCCGGGAATCCGTCATAGCC
GTGAGTGAGAATCTCCATCGCGGCTTGA
GTTGATCATTCTCTTTCGACTTTGCAGCTGGGCGGCCCTTCATGGACAGTAGAATTTGGCCGACGGGACAGTCCTGCGACCGTCGCCGCCGCAATGGAGGCCATTCCCAGCCCAAACCTC
ACTGCAACGCAGCTCATCCAGAGCTTCCAAAGGCGGGGTCTTTCCAAGCGTGATCTCGTAGCGCTTTCAGGAGGCCATTCCATCGGCCAGGCCCAGTGCTCTGCATTTAGCGCACGCCTC
TTCAATGGAACCCCAGGAGATAGCATCGATCGGGCCTTCAAATCTCGACTCGAGAAGAATTGCCCTCCAACAGCCCCAGACAGATTGACCAATTTGGATCCATCCCCCACCACCTTCGAC
AACTTGTACTTTCGAGCTCTCCTGGCGAATCAGTCGCTCCTCTTTTCAGACCAGCAGCTCTTGGAGATTGATCTGGTGGGCTTTGTCAAGGAGTTTGCGGCCAACCAGCAGACATTCTTT
ACCGCCTTCGCCAATGGCATGATCAAAATGGGCAAGCTCTCGCCAATCACAGCAGGGCATGGTGAAATTCGATCCTCGTGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCGATCCAAATTCCAGGCTCCAGTCGTCTCTGCAGCATTACTGCTGGTGCTAGCACTGCTGCGGCGCTATGCATTTTGCCAGGGATCACCAACAATGTCATTGGAGCTCTCAACT
TCTTTCTATGCTAACACTTGTCCCGATCTCCCTCAGATCGTGAGAAGTGTGATTCGCTCTGAATTTTCCAACGAAAGTCGATCTGCTGCGTCGATCCTCAAGCTCCACTTCCGAGATTGC
TTCTCTCGA
GGCTGCGACGGATCGCTGCTCCTCCAGCGAGGAGATGGGCGCTCCGCCAAGGGACTCAAAATCATCAACAACGTCAAGCGCGCCGTGGAGACTTCATGCCCGGCAACAGTA
TCGTGCGCGGACATTCTTGCGCTGAGCGCCCGGGAATCCGTCATAGCC
CTGGGCGGCCCTTCATGGACAGTAGAATTTGGCCGACGGGACAGTCCTGCGACCGTCGCCGCCGCAATGGAG
GCCATTCCCAGCCCAAACCTCACTGCAACGCAGCTCATCCAGAGCTTCCAAAGGCGGGGTCTTTCCAAGCGTGATCTCGTAGCGCTTTCAGGAGGCCATTCCATCGGCCAGGCCCAGTGC
TCTGCATTTAGCGCACGCCTCTTCAATGGAACCCCAGGAGATAGCATCGATCGGGCCTTCAAATCTCGACTCGAGAAGAATTGCCCTCCAACAGCCCCAGACAGATTGACCAATTTGGAT
CCATCCCCCACCACCTTCGACAACTTGTACTTTCGAGCTCTCCTGGCGAATCAGTCGCTCCTCTTTTCAGACCAGCAGCTCTTGGAGATTGATCTGGTGGGCTTTGTCAAGGAGTTTGCG
GCCAACCAGCAGACATTCTTTACCGCCTTCGCCAATGGCATGATCAAAATGGGCAAGCTCTCGCCAATCACAGCAGGGCATGGTGAAATTCGATCCTCGTGCTAG

Retrieve as FASTA