Entry information : SmPrx100-1_50 (SmPrx100a_50)
Entry ID 7115
Creation 2009-10-28 (Christophe Dunand)
Last sequence changes 2009-10-28 (Christophe Dunand)
Sequence status complete
Reviewer Paula Nunes
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx100-1_50 (SmPrx100a_50)
Name (synonym) SmPrx100-1_50 (SmPrx100a_50)
Class Class III peroxidase    [Orthogroup: Prx073]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx100-1_50
start..stop
S start..stop
SmPrx101-1_50 637 0 1..314 1..314
SmPrx102-1_50 583 0 1..314 1..314
SmPrx99-1_50 573 0 1..314 1..314
SmPrx98-1_50 561 0 1..314 1..314
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1129694..1129942 249 N° 2 1129987..1130145 159 N° 3 1130201..1130737 537  
join(1129694..1129942,1129987..1130145,1130201..1130737)


exon

Literature and cross-references SmPrx100-1_50 (SmPrx100a_50)
DNA ref. Phytozome 12:   scaffold_50 (1129694..1130737)
mRNA ref. JGI transcript:   115216 [Incorrect splicing]
Protein sequence: SmPrx100-1_50 (SmPrx100a_50)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   314
PWM (Da):   %s   33756.31 Transmb domain:   %s   i7-26o
PI (pH):   %s   9.14
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQRFKLQAPVAFAALLLVLALLRHYVFHQGSQIMSSELSTSFYVSTCPDLPQIVRSVIHSEFSNNSRSAASILKLHFQDCFAGGCDGSLLLQRGDGRSAKGLKTINNVKRAVETSCPATVSCADILALSARESVIALGGPSWTVEFGRRDSPATVATAMEAIPSPNLTATQLIERFQRRGLSKRDLVALSGGHSIGQAQCSAFSARLFNGTPGDSIDRAFKSRLEKNCPPTAPDRLTNLDPSPTTFDNLYFRALLANQSLLFSDQQLLQSDLVGFVKEFAANQQTFFTAFAAGMIKMGKLSPITGGHGEIRSSC*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2). No EST. Incorrect transcript prediction from JGI (short PS). No allelic variant!!!
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCGATTCAAACTTCAAGCTCCAGTCGCCTTTGCCGCATTACTACTAGTGCTAGCACTGCTGCGGCACTATGTATTTCACCAAGGATCACAAATAATGTCATCAGAGCTCTCAACT
TCTTTCTATGTTAGCACTTGTCCCGATCTCCCTCAGATCGTGAGAAGTGTGATTCACTCTGAATTTTCCAACAACAGTCGATCTGCTGCATCAATCCTCAAGCTCCACTTCCAAGATTGC
TTCGCTGGA
GTAAGTTAGAAATTAAAATAGCGTTGCTCATTAATGGCTGCCAGGGCTGCGACGGATCGCTGCTCCTCCAGCGAGGAGATGGGCGCTCCGCCAAGGGACTCAAAACCATCA
ACAACGTCAAGCGCGCCGTGGAGACTTCATGCCCGGCAACAGTATCGTGCGCGGACATTCTTGCGCTGAGCGCCCGTGAATCCGTCATAGCC
GTGAGTGAGAATCTCCATCGCGGCTTGA
GTTGATCATTCTCTTTCGACTTTGCAGCTGGGCGGCCCTTCATGGACAGTAGAATTTGGCCGACGGGACAGTCCCGCGACCGTCGCCACCGCAATGGAGGCCATTCCCAGCCCAAACCTC
ACCGCAACGCAGCTCATCGAGCGCTTCCAAAGGCGGGGTCTTTCCAAGCGTGATCTCGTAGCGCTTTCAGGAGGCCACTCCATCGGCCAGGCCCAGTGCTCTGCATTTAGCGCACGCCTC
TTCAATGGAACCCCAGGAGATAGCATCGATCGGGCCTTCAAATCTCGACTCGAGAAGAATTGCCCTCCAACAGCCCCAGACAGATTGACCAATTTGGATCCATCCCCCACCACCTTCGAC
AACTTGTACTTTCGAGCTCTCCTGGCCAATCAGTCGCTCCTCTTTTCAGACCAGCAGCTCTTGCAGAGTGATCTGGTGGGCTTTGTCAAGGAGTTTGCGGCCAATCAGCAGACGTTCTTT
ACCGCGTTCGCCGCTGGCATGATCAAAATGGGCAAGCTCTCGCCAATCACAGGAGGGCATGGTGAAATTCGATCCTCGTGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCGATTCAAACTTCAAGCTCCAGTCGCCTTTGCCGCATTACTACTAGTGCTAGCACTGCTGCGGCACTATGTATTTCACCAAGGATCACAAATAATGTCATCAGAGCTCTCAACT
TCTTTCTATGTTAGCACTTGTCCCGATCTCCCTCAGATCGTGAGAAGTGTGATTCACTCTGAATTTTCCAACAACAGTCGATCTGCTGCATCAATCCTCAAGCTCCACTTCCAAGATTGC
TTCGCTGGA
GGCTGCGACGGATCGCTGCTCCTCCAGCGAGGAGATGGGCGCTCCGCCAAGGGACTCAAAACCATCAACAACGTCAAGCGCGCCGTGGAGACTTCATGCCCGGCAACAGTA
TCGTGCGCGGACATTCTTGCGCTGAGCGCCCGTGAATCCGTCATAGCC
CTGGGCGGCCCTTCATGGACAGTAGAATTTGGCCGACGGGACAGTCCCGCGACCGTCGCCACCGCAATGGAG
GCCATTCCCAGCCCAAACCTCACCGCAACGCAGCTCATCGAGCGCTTCCAAAGGCGGGGTCTTTCCAAGCGTGATCTCGTAGCGCTTTCAGGAGGCCACTCCATCGGCCAGGCCCAGTGC
TCTGCATTTAGCGCACGCCTCTTCAATGGAACCCCAGGAGATAGCATCGATCGGGCCTTCAAATCTCGACTCGAGAAGAATTGCCCTCCAACAGCCCCAGACAGATTGACCAATTTGGAT
CCATCCCCCACCACCTTCGACAACTTGTACTTTCGAGCTCTCCTGGCCAATCAGTCGCTCCTCTTTTCAGACCAGCAGCTCTTGCAGAGTGATCTGGTGGGCTTTGTCAAGGAGTTTGCG
GCCAATCAGCAGACGTTCTTTACCGCGTTCGCCGCTGGCATGATCAAAATGGGCAAGCTCTCGCCAATCACAGGAGGGCATGGTGAAATTCGATCCTCGTGCTAG

Retrieve as FASTA