Entry information : SmPrx102-1_50 (SmPrx102a_50)
Entry ID 7117
Creation 2009-10-30 (Christophe Dunand)
Last sequence changes 2009-10-30 (Christophe Dunand)
Sequence status complete
Reviewer Paula Nunes
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx102-1_50 (SmPrx102a_50)
Name (synonym) SmPrx102-1_50 (SmPrx102a_50)
Class Class III peroxidase    [Orthogroup: Prx073]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx102-1_50
start..stop
S start..stop
SmPrx99-1_50 597 0 1..314 1..314
SmPrx98-1_50 587 0 1..314 1..314
SmPrx101-1_50 586 0 1..314 1..314
SmPrx100-1_50 583 0 1..314 1..314
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1153268..1153516 249 N° 2 1153561..1153719 159 N° 3 1153775..1154311 537  
join(1153268..1153516,1153561..1153719,1153775..1154311)


exon

Literature and cross-references SmPrx102-1_50 (SmPrx102a_50)
DNA ref. Phytozome 12:   scaffold_50 (1153268..1154311)
mRNA ref. JGI transcript:   233807 [Incorrect prediction]
Protein sequence: SmPrx102-1_50 (SmPrx102a_50)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   314 (286)
PWM (Da):   %s   33632.27 (30495.4)  
PI (pH):   %s   9.65 (8.50) Peptide Signal:   %s   cut: 29 range:29-314
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQRSKLQAPVASAALLLVLALLRRYAFRQGSPTMSSELSTSFYASTCPDLPQIVRSVIHSEFSNDSRSAASILKLHFRDCFSRGCDGSLLLQRGDGRSAKGLKIINNVKRAVETSCPATVSCADILALSARESVIALGGPSWTVEFGRRDSPATVAAAMEAIPSPNLTATQLIESFQRRGLSKRDLVALSGGHSIGQAQCSAFSARLFNGTPGDSIDRAFKSRLEKNCPPTAPDRLTNLDPSPTTFDNLYFRALLANQSLLFSDQQLLQSDLVGFVKEFAANQQTFFTAFAAGMIKMGKLSPITGGHGEIRSSC*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2). No EST. Incorrect transcript prediction from JGI (short PS). No allelic variant!!!
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCGATCCAAACTCCAGGCTCCAGTCGCCTCTGCGGCATTACTGCTGGTGCTAGCACTGCTGCGGCGCTATGCATTTCGCCAGGGATCACCAACAATGTCATCGGAGCTCTCAACT
TCTTTCTATGCCAGCACTTGTCCCGATCTCCCTCAGATCGTGAGAAGTGTGATTCACTCTGAATTTTCCAACGACAGTCGATCTGCTGCGTCGATCCTCAAGCTCCACTTCCGAGATTGC
TTCTCTCGA
GTAAGTCAGAAATTAAAATAGCGTTACTCATTTATGGCTGCCAGGGCTGCGACGGATCGCTGCTCCTCCAGCGAGGAGATGGGCGCTCCGCCAAGGGACTCAAAATCATCA
ACAACGTCAAGCGCGCCGTGGAGACTTCATGCCCGGCAACAGTATCGTGCGCGGACATTCTTGCGCTGAGCGCCCGGGAATCCGTCATAGCC
GTGAGTGAGAATCTCCATCGCGGCTTGA
GTTGATCATTCTCTTTCGACTTTGCAGCTGGGCGGCCCTTCATGGACAGTAGAATTTGGCCGACGGGACAGTCCTGCGACCGTCGCCGCCGCAATGGAGGCCATTCCCAGCCCAAACCTC
ACTGCAACGCAGCTCATCGAGAGCTTCCAAAGGCGGGGTCTTTCCAAGCGTGATCTCGTAGCGCTTTCAGGAGGCCACTCCATCGGCCAGGCCCAGTGCTCTGCATTTAGCGCACGCCTC
TTCAATGGAACCCCAGGAGATAGCATCGATCGGGCCTTCAAATCTCGACTCGAGAAGAATTGCCCTCCAACAGCCCCAGACAGATTGACCAATTTGGATCCATCCCCCACCACCTTCGAC
AACTTGTACTTTCGAGCTCTCCTGGCCAATCAGTCGCTCCTCTTTTCAGACCAGCAGCTCTTGCAGAGTGATCTGGTGGGCTTTGTCAAGGAGTTTGCGGCCAATCAGCAGACGTTCTTT
ACCGCGTTCGCCGCTGGCATGATCAAAATGGGCAAGCTCTCGCCAATCACAGGAGGGCATGGTGAAATTCGATCCTCGTGCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCGATCCAAACTCCAGGCTCCAGTCGCCTCTGCGGCATTACTGCTGGTGCTAGCACTGCTGCGGCGCTATGCATTTCGCCAGGGATCACCAACAATGTCATCGGAGCTCTCAACT
TCTTTCTATGCCAGCACTTGTCCCGATCTCCCTCAGATCGTGAGAAGTGTGATTCACTCTGAATTTTCCAACGACAGTCGATCTGCTGCGTCGATCCTCAAGCTCCACTTCCGAGATTGC
TTCTCTCGA
GGCTGCGACGGATCGCTGCTCCTCCAGCGAGGAGATGGGCGCTCCGCCAAGGGACTCAAAATCATCAACAACGTCAAGCGCGCCGTGGAGACTTCATGCCCGGCAACAGTA
TCGTGCGCGGACATTCTTGCGCTGAGCGCCCGGGAATCCGTCATAGCC
CTGGGCGGCCCTTCATGGACAGTAGAATTTGGCCGACGGGACAGTCCTGCGACCGTCGCCGCCGCAATGGAG
GCCATTCCCAGCCCAAACCTCACTGCAACGCAGCTCATCGAGAGCTTCCAAAGGCGGGGTCTTTCCAAGCGTGATCTCGTAGCGCTTTCAGGAGGCCACTCCATCGGCCAGGCCCAGTGC
TCTGCATTTAGCGCACGCCTCTTCAATGGAACCCCAGGAGATAGCATCGATCGGGCCTTCAAATCTCGACTCGAGAAGAATTGCCCTCCAACAGCCCCAGACAGATTGACCAATTTGGAT
CCATCCCCCACCACCTTCGACAACTTGTACTTTCGAGCTCTCCTGGCCAATCAGTCGCTCCTCTTTTCAGACCAGCAGCTCTTGCAGAGTGATCTGGTGGGCTTTGTCAAGGAGTTTGCG
GCCAATCAGCAGACGTTCTTTACCGCGTTCGCCGCTGGCATGATCAAAATGGGCAAGCTCTCGCCAATCACAGGAGGGCATGGTGAAATTCGATCCTCGTGCTAG

Retrieve as FASTA