Entry information : SmPrx104-1_151 (SmPrx104a_151)
Entry ID 7120
Creation 2009-10-30 (Christophe Dunand)
Last sequence changes 2009-10-30 (Christophe Dunand)
Sequence status complete
Reviewer Paula Nunes
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx104-1_151 (SmPrx104a_151)
Name (synonym) SmPrx104-1_151 (SmPrx104a_151)
Class Class III peroxidase    [Orthogroup: Prx047]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx104-1_151
start..stop
S start..stop
SmPrx104-2_171 704 0 1..340 1..340
SmPrx30-2_131 649 0 4..340 1..336
SmPrx30-1_84 647 0 4..337 1..333
SmPrx13-2_57 410 1e-144 32..335 34..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 75792..76013 222 N° 2 76065..76262 198 N° 3 76370..76535 166 N° 4 76593..77029 437
join(75792..76013,76065..76262,76370..76535,76593..77029)


exon

Literature and cross-references SmPrx104-1_151 (SmPrx104a_151)
DNA ref. Phytozome 12:   scaffold_151 (75792..77029)
mRNA ref. JGI transcript:   136759 [Incorrect prediction]
Protein sequence: SmPrx104-1_151 (SmPrx104a_151)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   340 (310)
PWM (Da):   %s   37844.9 (34479.1)  
PI (pH):   %s   9.05 (8.73) Peptide Signal:   %s   cut: 31 range:31-340
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MYYMAFPKRAAVWTLVAVLLSLISSRDVLASHSYERTCPNAEWIIRDTINEHASRDPTIPAGLIRLHFHDCFVNGCDGSILLDSTPTDGTNVERFAPPNRDSVRGFEIIEDAKRRLEQACPGIVSCADTVAIAARDSTVRMGGQHYKVATGRYDGRVSSLQLATKFLPSPSMDASTLIKNFKNQGLSVEDLVVLSGAHTLGTSKCNFFASGRFDRLYNFRNTSRADKTVNPAYLQHLRSRCPRDGSANTVELDRGSQFSFDNSYFKNLERRNGLLTSDQVLFESERTSGLVRSYAYNSRQFASHFGQSMVRMGSIGWKTKENGEIRRVCNAVNVNKHDTL

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST. Incorrect prediction from JGI (first exon is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTACTATATGGCGTTTCCAAAGAGAGCAGCAGTGTGGACACTAGTAGCAGTATTGCTGTCTTTGATCAGCTCCAGGGATGTTTTGGCATCGCACAGCTATGAAAGAACTTGCCCAAAT
GCGGAGTGGATCATCCGAGACACGATCAACGAGCATGCTAGCCGGGACCCAACAATCCCCGCGGGACTGATTCGCTTGCACTTCCACGACTGCTTCGTCAAC
GTAAGCTAGCTATGAATT
CACCAGTTTTCTCACCTTGCCTGATCACACCAGGGTTGCGATGGCTCCATCCTTCTTGATTCCACTCCAACAGACGGTACCAATGTCGAGAGATTCGCTCCTCCAAACCGGGACTCCGTC
CGAGGATTTGAAATTATCGAGGATGCGAAAAGAAGGCTGGAACAGGCTTGTCCTGGTATAGTTTCTTGTGCCGACACTGTGGCCATCGCCGCAAGAGATTCAACTGTCAGG
GTGAGTTCC
TAATTGATAGTGGATTTTTCGCTCCACCATAGCCATCTTTTCTTCTTCTCCTCCTTCTTCTTCGTCTTCTCTCATATTTGGGTCTTCGATTCGTATAGATGGGAGGCCAGCACTACAAAG
TAGCCACTGGACGCTATGATGGACGGGTGTCGAGCTTGCAACTCGCCACAAAGTTTCTACCATCGCCATCCATGGACGCCTCGACTCTCATAAAAAATTTCAAGAACCAAGGCTTGTCCG
TTGAAGACCTTGTCGTTCTGTCAG
GTGAGATCATTCGACTTTGCTAGTTGGATTTGGAATCGATCGACTTTAATTTGTCAGGAGCTCACACACTGGGAACCTCCAAATGCAACTTCTTCG
CGAGCGGTCGCTTCGACCGCCTGTACAACTTCAGGAACACGAGCAGAGCCGACAAGACAGTAAACCCTGCGTACTTGCAGCACCTCCGCAGCAGATGCCCGCGCGATGGGTCCGCAAACA
CGGTGGAGCTTGACAGGGGTTCGCAGTTCAGCTTTGACAACTCCTACTTCAAGAATTTGGAACGGAGGAACGGACTTCTCACCTCTGACCAGGTGCTGTTCGAGAGCGAACGCACGAGTG
GACTTGTTCGATCCTACGCCTACAATTCCAGGCAGTTTGCGTCTCATTTTGGGCAATCTATGGTAAGAATGGGAAGCATCGGGTGGAAGACGAAAGAGAATGGGGAGATCAGAAGGGTGT
GTAATGCCGTGAATGTAAATAAACACGACACTTTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTACTATATGGCGTTTCCAAAGAGAGCAGCAGTGTGGACACTAGTAGCAGTATTGCTGTCTTTGATCAGCTCCAGGGATGTTTTGGCATCGCACAGCTATGAAAGAACTTGCCCAAAT
GCGGAGTGGATCATCCGAGACACGATCAACGAGCATGCTAGCCGGGACCCAACAATCCCCGCGGGACTGATTCGCTTGCACTTCCACGACTGCTTCGTCAAC
GGTTGCGATGGCTCCATC
CTTCTTGATTCCACTCCAACAGACGGTACCAATGTCGAGAGATTCGCTCCTCCAAACCGGGACTCCGTCCGAGGATTTGAAATTATCGAGGATGCGAAAAGAAGGCTGGAACAGGCTTGT
CCTGGTATAGTTTCTTGTGCCGACACTGTGGCCATCGCCGCAAGAGATTCAACTGTCAGG
ATGGGAGGCCAGCACTACAAAGTAGCCACTGGACGCTATGATGGACGGGTGTCGAGCTTG
CAACTCGCCACAAAGTTTCTACCATCGCCATCCATGGACGCCTCGACTCTCATAAAAAATTTCAAGAACCAAGGCTTGTCCGTTGAAGACCTTGTCGTTCTGTCAG
GAGCTCACACACTG
GGAACCTCCAAATGCAACTTCTTCGCGAGCGGTCGCTTCGACCGCCTGTACAACTTCAGGAACACGAGCAGAGCCGACAAGACAGTAAACCCTGCGTACTTGCAGCACCTCCGCAGCAGA
TGCCCGCGCGATGGGTCCGCAAACACGGTGGAGCTTGACAGGGGTTCGCAGTTCAGCTTTGACAACTCCTACTTCAAGAATTTGGAACGGAGGAACGGACTTCTCACCTCTGACCAGGTG
CTGTTCGAGAGCGAACGCACGAGTGGACTTGTTCGATCCTACGCCTACAATTCCAGGCAGTTTGCGTCTCATTTTGGGCAATCTATGGTAAGAATGGGAAGCATCGGGTGGAAGACGAAA
GAGAATGGGGAGATCAGAAGGGTGTGTAATGCCGTGAATGTAAATAAACACGACACTTTGTAA

Retrieve as FASTA