Entry information : SmPrx104-2_171 (SmPrx104b_171)
Entry ID 7123
Creation 2009-10-30 (Christophe Dunand)
Last sequence changes 2009-10-30 (Christophe Dunand)
Sequence status complete
Reviewer Paula Nunes
Last annotation changes 2011-01-25 (Toky Ramarohetra (Scipio))
Peroxidase information: SmPrx104-2_171 (SmPrx104b_171)
Name (synonym) SmPrx104-2_171 (SmPrx104b_171)
Class Class III peroxidase    [Orthogroup: Prx047]
Taxonomy Eukaryota Viridiplantae Streptophyta Isoetopsida Selaginellaceae Selaginella
Organism Selaginella moellendorffii    [TaxId: 88036 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SmPrx104-2_171
start..stop
S start..stop
SmPrx104-1_151 704 0 1..340 1..340
SmPrx30-2_131 647 0 4..340 1..336
SmPrx30-1_84 645 0 4..337 1..333
SmPrx13-2_57 410 1e-144 32..335 34..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 88420..88641 222 N° 2 88698..88895 198 N° 3 89003..89168 166 N° 4 89226..89662 437
join(88420..88641,88698..88895,89003..89168,89226..89662)


exon

Literature and cross-references SmPrx104-2_171 (SmPrx104b_171)
DNA ref. Phytozome 12:   scaffold_171 (88420..89662)
mRNA ref. JGI transcript:   137617 [Incorrect splicing]
Protein sequence: SmPrx104-2_171 (SmPrx104b_171)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   340 (315)
PWM (Da):   %s   37855.87 (35034.3)  
PI (pH):   %s   8.72 (8.40) Peptide Signal:   %s   cut: 31 range:26-340
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MYYMAFPKRAAVWTLVAVLLPLISSRDVLASHSYERTCPNAEWIIRDTINEHASRDPTIPAGLIRLHFHDCFVNGCDGSILLDSTPTDGTNVERFAPPNRDSVRGFEIIEDAKRRLEQACPGIVSCADTVAIAARDSTVRMGGQHYKVATGRYDGRVSSLQLATKFLPSPSMDASTLIKNFKNQGLSVEDLVVLSGAHTLGTSKCNFFASGRFDRLYNFRNTSRADETVNPAYLQHLRSRCPRDGSANTVELDRGSQFSFDNSYFKNLERRNGLLTSDQVLFESERTSGLVRSYAYNSRQFASHFGQSMVRMGSIGWKTKENGEIRRVCNAVNVNKHDTL

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). No EST. Incorrect prediction from JGI (first exon is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTACTATATGGCGTTTCCAAAGAGAGCAGCAGTGTGGACACTAGTAGCAGTATTGCTCCCTTTGATCAGCTCCAGGGATGTTTTGGCATCGCACAGCTATGAAAGAACTTGCCCAAAT
GCGGAGTGGATCATCCGAGACACGATCAACGAGCATGCTAGCCGGGACCCAACAATCCCCGCGGGACTGATTCGCTTGCACTTCCACGACTGCTTCGTCAAC
GTAAGCTAGCTACAAGAT
GAATTCACCAGTTTTCTCACCTTGCCTGATCACACCAGGGTTGCGATGGCTCCATCCTTCTCGATTCCACTCCAACAGACGGTACCAATGTCGAGAGATTCGCTCCTCCAAACCGGGACT
CCGTCCGAGGATTTGAAATTATCGAGGATGCGAAAAGAAGGCTGGAACAGGCTTGTCCTGGTATAGTTTCTTGTGCCGACACTGTGGCCATCGCCGCAAGAGATTCAACTGTCAGG
GTGA
GTTCTTGATTGATAGTGGATTTTTCGCTCCACCATAGCTATCTTTTCTTCTTCTTCTCCTTCTTCTTCGTCTTCTCTCATATTTGGGCCTTCGATTCGTATAGATGGGAGGCCAGCACTA
CAAAGTAGCCACTGGACGCTATGATGGACGGGTGTCGAGCTTGCAACTCGCCACAAAGTTTCTACCATCGCCATCCATGGACGCCTCGACTCTCATAAAAAATTTCAAGAACCAAGGCTT
GTCCGTTGAAGACCTTGTCGTTCTGTCAG
GTGAGATCATTCGACTTTGCTAGTTGGATTTGGAATCGATCGACTTTAATTTGTCAGGAGCTCACACACTGGGAACCTCCAAATGCAACTT
CTTCGCGAGCGGCCGCTTCGACCGCCTGTACAACTTCAGGAACACGAGCAGAGCCGACGAGACAGTAAATCCTGCGTACTTGCAGCACCTCCGCAGCAGATGCCCGCGCGATGGGTCCGC
AAACACGGTGGAGCTTGACAGGGGTTCGCAGTTCAGCTTTGACAACTCCTACTTCAAGAATTTGGAGCGGAGGAACGGACTTCTCACCTCTGACCAGGTGCTGTTCGAGAGCGAACGCAC
GAGTGGACTTGTTCGATCCTACGCCTACAATTCCAGGCAGTTTGCGTCTCATTTTGGGCAATCTATGGTAAGAATGGGAAGCATCGGGTGGAAAACGAAAGAGAATGGGGAGATCAGAAG
GGTGTGTAATGCCGTGAATGTAAATAAACACGACACTTTGTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTACTATATGGCGTTTCCAAAGAGAGCAGCAGTGTGGACACTAGTAGCAGTATTGCTCCCTTTGATCAGCTCCAGGGATGTTTTGGCATCGCACAGCTATGAAAGAACTTGCCCAAAT
GCGGAGTGGATCATCCGAGACACGATCAACGAGCATGCTAGCCGGGACCCAACAATCCCCGCGGGACTGATTCGCTTGCACTTCCACGACTGCTTCGTCAAC
GGTTGCGATGGCTCCATC
CTTCTCGATTCCACTCCAACAGACGGTACCAATGTCGAGAGATTCGCTCCTCCAAACCGGGACTCCGTCCGAGGATTTGAAATTATCGAGGATGCGAAAAGAAGGCTGGAACAGGCTTGT
CCTGGTATAGTTTCTTGTGCCGACACTGTGGCCATCGCCGCAAGAGATTCAACTGTCAGG
ATGGGAGGCCAGCACTACAAAGTAGCCACTGGACGCTATGATGGACGGGTGTCGAGCTTG
CAACTCGCCACAAAGTTTCTACCATCGCCATCCATGGACGCCTCGACTCTCATAAAAAATTTCAAGAACCAAGGCTTGTCCGTTGAAGACCTTGTCGTTCTGTCAG
GAGCTCACACACTG
GGAACCTCCAAATGCAACTTCTTCGCGAGCGGCCGCTTCGACCGCCTGTACAACTTCAGGAACACGAGCAGAGCCGACGAGACAGTAAATCCTGCGTACTTGCAGCACCTCCGCAGCAGA
TGCCCGCGCGATGGGTCCGCAAACACGGTGGAGCTTGACAGGGGTTCGCAGTTCAGCTTTGACAACTCCTACTTCAAGAATTTGGAGCGGAGGAACGGACTTCTCACCTCTGACCAGGTG
CTGTTCGAGAGCGAACGCACGAGTGGACTTGTTCGATCCTACGCCTACAATTCCAGGCAGTTTGCGTCTCATTTTGGGCAATCTATGGTAAGAATGGGAAGCATCGGGTGGAAAACGAAA
GAGAATGGGGAGATCAGAAGGGTGTGTAATGCCGTGAATGTAAATAAACACGACACTTTGTAA

Retrieve as FASTA